User:Katherine H. Loh: Difference between revisions
Line 62: | Line 62: | ||
FLAP landing sequence | FLAP landing sequence | ||
5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’ | 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’ | ||
==Useful links== | ==Useful links== | ||
*[[OpenWetWare:Welcome|Introductory tutorial]] | *[[OpenWetWare:Welcome|Introductory tutorial]] | ||
*[[Help|OpenWetWare help pages]] | *[[Help|OpenWetWare help pages]] |
Revision as of 10:47, 16 November 2008
I am a new member of OpenWetWare!
Contact Info
- Katherine H. Loh
- Massachusetts Institute of Technology
- Email me through OpenWetWare
Art/Biotechnology Exhibit
Current interactions between science and the public
a description of existing ways the public can interact with science (and/or) how a new model for an interactive laboratory can fit into the history of science and knowledge (and/or) your ideas about citizenship and biological engineering
Public perceptions of science are shaped largely by the few high-profile breakthroughs propagated through the media. As a result, the general public often cannot appreciate menial successes and are not involved in the entire scientific process. Currently, there are some innovative and often artistic interfaces where the public can approach science differently; these lead to a better understanding and improved appreciation of the elegance of science. For example, groups such as the League of Imaginary Scientists try to make scientific concepts more accessible through videos, art exhibits, etc. Additionally, the Science Gallery at Trinity College in Dublin houses displays which encourage viewers to see science from new and different perspectives. Still, further promotion of the interaction between the public and science is needed, and a new model for an interactive laboratory can help pave the way to.......
Partial Ideas!
Yeast light bulb
- color change
- faster multiplication
- colony patterns, size, clumping
- gradient of environment
- displays of proteins
- can produce ethanol
- simple sugar (fructose, glucose, galactose) --> ethanol
- root beer production?
- time scale: 13-164 minutes?
- see previous changes, record of what has happened - different time scale
Bacteria (fast-forwarded)
- show movement and interaction of (maybe different kinds of) bacteria to show their behaviors on a different time scale
- Planet Earth
C.elegans
- use different colors of GFP and then capture images using long exposure
- Stained and moving C. elegans
Funny cheese!
- present food/products made using bacteria etc. in different ways i.e. arrange petri dishes in the shape of swiss cheese with bacteria where the holes should be
- GFPixel
Plans (to be filled in later)
- Exhibit
- Timing diagram
- "Parts" and "devices"
- Laboratory
Resources
Societal Impact
Mod 2: Protein Engineering
Day 1: PCR Primers Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’
Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’