User:Katherine H. Loh
From OpenWetWare
I am a new member of OpenWetWare!
Contact Info
- Katherine H. Loh
- Massachusetts Institute of Technology
- Address 1
- Address 2
- City, State, Country etc.
- Email me through OpenWetWare
Art/Biotechnology Exhibit
Current interactions between science and the public
Goals and summary
Plans
- Exhibit
- Timing diagram
- "Parts" and "devices"
- Laboratory
- First experimental steps
- Control experiment
Resources
Societal Impact
Mod 2: Protein Engineering
Day 1: PCR Primers Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’
Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’
Registration/Questionnaire: 20.109 Fall 2008
Last Name
Loh
First Name
Katherine
Preferred name
Katie
Course/Minor
20
Year of Graduation
2011
Telephone #
kloh AT mit DOT edu
Anything else you would like us to know?
Education
- Year, PhD, Institute
- Year, MS, Institute
- Year, BS, Institute
Research interests
- Interest 1
- Interest 2
- Interest 3
Publications
- Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 |
- JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 |
leave a comment about a paper here
- ISBN:0879697164
