User:Lindenb/Notebook/UMR915/20101104: Difference between revisions
From OpenWetWare
(→GEM) |
|||
Line 48: | Line 48: | ||
Thu Nov 4 21:57:26 2010 | Thu Nov 4 21:57:26 2010 | ||
</pre> | </pre> | ||
===Results=== | |||
[lindenb@srv-clc-02 lindenb]$ ls -lah soap_results.data unpaired.data | |||
-rw-r--r-- 1 lindenb users 4.8G Nov 4 21:57 soap_results.data | |||
-rw-r--r-- 1 lindenb users 5.7G Nov 4 21:57 unpaired.data | |||
<pre> file soap_results.data unpaired.data | |||
soap_results.data: ASCII text | |||
unpaired.data: ASCII text</pre> | |||
<pre>[lindenb@srv-clc-02 lindenb]$ more soap_results.data | |||
IL36_4366:3:1:1056:15626/1 CCAAGGGAGCTTATTAGTCCCTTCCACCATGTGAGGACGCAAGAAGGCATCATC 9305(3-=<8)<?/9:+48?;(5:6=@C:;4<==-?;C9<?8<ABA3CBA?A5E 1 a 54 - chr7 36927164054M 54 | |||
IL36_4366:3:1:1056:15626/2 GAAATGCCGTCTTGCTTGAAAAGTCCTTCTTAACTCTCCCACAAGTCACTCTCT E-E4EEAE?59>=C9A7?A:=E?@A:;)4:<8488=;B<=6*.2;*8<+4)=98 1 b 54 + chr7 36926895054M 54 | |||
IL36_4366:3:1:1059:7264/1 TCTTTCTTCAGCTTCTTGGGCGAAACAGGGAGTCTTTCCTGTGGACTCAGCTTG 8437CE=AA=+C<?>:36.11@@@.CFBFA9<B>@==@>C;55;A<-1>;F;-? 2 a 54 - chr17 40983027054M 54 | |||
IL36_4366:3:1:1059:7264/2 TCTTCAAGGGTCTCTGGATTTTGAGTTTCGGGCTCTAGATGGAATTGAGAAGGT D>DD7DB8BAA-BD?@=94B4AAAA3>@AD<;6-6=DDA8*=7>4)<=<<9<3= 2 b 54 + chr17 40982790054M 54</pre> | |||
<pre>[lindenb@srv-clc-02 lindenb]$ more unpaired.data | |||
IL36_4366:3:1:1053:17041/1 AGACAGCAGTTAGTTGGTTGGTGAGTTCTTATCCATTCTGCTGTTCTGTATCTT =<@=;@B>;30</C99*>0@=D4E7>:>8@+1@8BDD:ABAC@<CDABDBE8DB 4 a 54 - chr4 | |||
92885278 2 A->41T3 G->9T-13 54M 9G31A12 | |||
IL36_4366:3:1:1053:7122/1 GGCAGTGCCTCTACCCTCCTCCTTAAGTTTCTATGGTCCCTGCTGCTCCTGGCC 5)8(6+8?@>@--9?;,4>3=E?A@@8@6;?;+?B*?;?@;5A@'>2>:>40>A 1 a 54 - chr6 | |||
31233127 0 54M 54 | |||
IL36_4366:3:1:1053:7122/2 GAAAGAGACAGACTGAGAGGGGCTCTGAGGCTTTACTCATACTTTCAGGATTCT $6&')$'&4926<-..6%,%-)%68/8=84+-4<(-*/*.6(52*2.D/&-5/% 1 b 54 + chr6 | |||
31233072 0 54M 54</pre> | |||
==Galaxy== | ==Galaxy== |
Revision as of 01:58, 5 November 2010
SOAPAligner
testing soap aligner:
soap2.20release/soap -a xx_3_1.fastq.gz -bxx_3_2.fastq.gz -D hg18.fa.index -o ~/soap_results.data -2 ~/unpaired.data File Error: unrecognized file
hum... it doesn't like the gzipped fastq ?... :-/ unzippinf...
/usr/local/package/soap2.20release/soap -a XX_3_1.fastq -b XX_3_2.fastq -D hg18.fa.index -o soap_results.data -2 unpaired.data -m 200 -x 600
Begin Program SOAPaligner/soap2 Thu Nov 4 11:18:24 2010 Reference: hg18.fa.index Query File a: 4366_3_1.fastq Query File b: 4366_3_2.fastq Output File: soap_results.data unpaired.data Load Index Table ... Load Index Table OK Begin Alignment ... 131072 ok 86.16 sec 262144 ok 84.23 sec 393216 ok 93.31 sec 524288 ok 90.48 sec (...) 70254592 ok 62.22 sec 70385664 ok 58.87 sec 70516736 ok 59.30 sec 70647808 ok 58.74 sec 70778880 ok 59.80 sec 70909952 ok 55.67 sec 71041024 ok 55.21 sec 71172096 ok 52.78 sec 71303168 ok 54.85 sec 71434240 ok 59.92 sec 71473618 ok 17.14 sec Total Pairs: 35736809 PE Paired: 14641084 (40.97%) PE Singled: 34692762 (48.54%) SE Total Elapsed Time: 33175.70 - Load Index Table: 14.96 - Alignment: 33160.74 SOAPaligner/soap2 End Thu Nov 4 21:57:26 2010
Results
[lindenb@srv-clc-02 lindenb]$ ls -lah soap_results.data unpaired.data -rw-r--r-- 1 lindenb users 4.8G Nov 4 21:57 soap_results.data -rw-r--r-- 1 lindenb users 5.7G Nov 4 21:57 unpaired.data
file soap_results.data unpaired.data soap_results.data: ASCII text unpaired.data: ASCII text
[lindenb@srv-clc-02 lindenb]$ more soap_results.data IL36_4366:3:1:1056:15626/1 CCAAGGGAGCTTATTAGTCCCTTCCACCATGTGAGGACGCAAGAAGGCATCATC 9305(3-=<8)<?/9:+48?;(5:6=@C:;4<==-?;C9<?8<ABA3CBA?A5E 1 a 54 - chr7 36927164054M 54 IL36_4366:3:1:1056:15626/2 GAAATGCCGTCTTGCTTGAAAAGTCCTTCTTAACTCTCCCACAAGTCACTCTCT E-E4EEAE?59>=C9A7?A:=E?@A:;)4:<8488=;B<=6*.2;*8<+4)=98 1 b 54 + chr7 36926895054M 54 IL36_4366:3:1:1059:7264/1 TCTTTCTTCAGCTTCTTGGGCGAAACAGGGAGTCTTTCCTGTGGACTCAGCTTG 8437CE=AA=+C<?>:36.11@@@.CFBFA9<B>@==@>C;55;A<-1>;F;-? 2 a 54 - chr17 40983027054M 54 IL36_4366:3:1:1059:7264/2 TCTTCAAGGGTCTCTGGATTTTGAGTTTCGGGCTCTAGATGGAATTGAGAAGGT D>DD7DB8BAA-BD?@=94B4AAAA3>@AD<;6-6=DDA8*=7>4)<=<<9<3= 2 b 54 + chr17 40982790054M 54
[lindenb@srv-clc-02 lindenb]$ more unpaired.data IL36_4366:3:1:1053:17041/1 AGACAGCAGTTAGTTGGTTGGTGAGTTCTTATCCATTCTGCTGTTCTGTATCTT =<@=;@B>;30</C99*>0@=D4E7>:>8@+1@8BDD:ABAC@<CDABDBE8DB 4 a 54 - chr4 92885278 2 A->41T3 G->9T-13 54M 9G31A12 IL36_4366:3:1:1053:7122/1 GGCAGTGCCTCTACCCTCCTCCTTAAGTTTCTATGGTCCCTGCTGCTCCTGGCC 5)8(6+8?@>@--9?;,4>3=E?A@@8@6;?;+?B*?;?@;5A@'>2>:>40>A 1 a 54 - chr6 31233127 0 54M 54 IL36_4366:3:1:1053:7122/2 GAAAGAGACAGACTGAGAGGGGCTCTGAGGCTTTACTCATACTTTCAGGATTCT $6&')$'&4926<-..6%,%-)%68/8=84+-4<(-*/*.6(52*2.D/&-5/% 1 b 54 + chr6 31233072 0 54M 54
Galaxy
wget "http://bitbucket.org/galaxy/galaxy-dist/get/tip.zip" unzip tip.zip cd galaxy-dist sh setup.sh Copying datatypes_conf.xml.sample to datatypes_conf.xml Copying reports_wsgi.ini.sample to reports_wsgi.ini Copying tool_conf.xml.sample to tool_conf.xml Copying tool_data_table_conf.xml.sample to tool_data_table_conf.xml Copying universe_wsgi.ini.sample to universe_wsgi.ini Copying tool-data/alignseq.loc.sample to tool-data/alignseq.loc Copying tool-data/annotation_profiler_options.xml.sample to tool-data/annotation_profiler_options.xml Copying tool-data/annotation_profiler_valid_builds.txt.sample to tool-data/annotation_profiler_valid_builds.txt Copying tool-data/bfast_indexes.loc.sample to tool-data/bfast_indexes.loc Copying tool-data/binned_scores.loc.sample to tool-data/binned_scores.loc Copying tool-data/blastdb.loc.sample to tool-data/blastdb.loc Copying tool-data/bowtie_indices.loc.sample to tool-data/bowtie_indices.loc Copying tool-data/bowtie_indices_color.loc.sample to tool-data/bowtie_indices_color.loc Copying tool-data/encode_datasets.loc.sample to tool-data/encode_datasets.loc Copying tool-data/liftOver.loc.sample to tool-data/liftOver.loc Copying tool-data/maf_index.loc.sample to tool-data/maf_index.loc Copying tool-data/maf_pairwise.loc.sample to tool-data/maf_pairwise.loc Copying tool-data/microbial_data.loc.sample to tool-data/microbial_data.loc Copying tool-data/phastOdds.loc.sample to tool-data/phastOdds.loc Copying tool-data/quality_scores.loc.sample to tool-data/quality_scores.loc Copying tool-data/regions.loc.sample to tool-data/regions.loc Copying tool-data/sam_fa_indices.loc.sample to tool-data/sam_fa_indices.loc Copying tool-data/srma_index.loc.sample to tool-data/srma_index.loc Copying tool-data/twobit.loc.sample to tool-data/twobit.loc Copying tool-data/shared/ucsc/builds.txt.sample to tool-data/shared/ucsc/builds.txt Creating database/files Creating database/community_files Creating database/tmp Creating database/compiled_templates Creating database/job_working_directory Creating database/import Creating database/pbs Creating static/genetrack/plots Creating tool-data/shared/jars One or more of the python eggs necessary to run Galaxy couldn't be downloaded automatically. You can try building them by hand (all at once) with: python scripts/scramble.py Or individually: python scripts/scramble.py Mako python scripts/scramble.py Babel python scripts/scramble.py Whoosh python scripts/scramble.py Tempita python scripts/scramble.py Cheetah python scripts/scramble.py lrucache python scripts/scramble.py sqlalchemy_migrate python scripts/scramble.py NoseHTML python scripts/scramble.py pexpect python scripts/scramble.py bx_python python scripts/scramble.py PasteDeploy python scripts/scramble.py WebHelpers python scripts/scramble.py docutils python scripts/scramble.py numpy python scripts/scramble.py pysqlite python scripts/scramble.py Beaker python scripts/scramble.py SVGFig python scripts/scramble.py SQLAlchemy python scripts/scramble.py simplejson python scripts/scramble.py WebError python scripts/scramble.py python_lzo python scripts/scramble.py wchartype python scripts/scramble.py twill python scripts/scramble.py Routes python scripts/scramble.py elementtree python scripts/scramble.py decorator python scripts/scramble.py pycrypto python scripts/scramble.py Paste python scripts/scramble.py wsgiref python scripts/scramble.py nose python scripts/scramble.py amqplib python scripts/scramble.py WebOb python scripts/scramble.py PasteScript
tomcat already running on port 8080: edit universe_wsgi.ini and change
port=8020
but problem with the proxy
GEM
> gem-mapper Welcome to GEM-mapper build 544 (beta) - (2009/10/07 02:50:12 GMT) (c) 2008-2010 Paolo Ribeca <paolo.ribeca@gmail.com> ************************************************************************ * WARNING: this is a beta version, provided for testing purposes only; * * check for updates at <http://www.paoloribeca.net/software/GEM>. * ************************************************************************ Names of index, input and output file are mandatory Usage: gem-mapper -I <index_prefix> (mandatory) -c|--colorspace (index is colorspace-encoded) -e|--emulate-complement (for indices lacking it) -i <input_file> (mandatory, FASTA or FASTQ) -q|--quality-format 'ignore'|'phred'|'solexa' (mandatory with FASTQ input) --reads-per-block <number> (default=10000) -o <output_prefix> (mandatory) -t <thread_number> (default=1) -m <max_mismatch_number> (default=2) --mismatch-alphabet <symbols> (default="ACGT") -Q|--quality-model 'gem'|'flat' (default='gem') --gem-quality-threshold <number> (default=26, that is e<=2e-3) -d|--decoding-threshold 'all'|<number> (default=10) --filtering-threshold <number> (default=40) --max-indel-length <number> (default=5) --disable-accelerators (for debugging purposes) -h|--help (print usage)
no paired-end sequencing ?
gem-mapper -i XXXX_1.fastq -o gemout -I gemhg18 -q phred Welcome to GEM-mapper build 544 (beta) - (2009/10/07 02:50:12 GMT) (c) 2008-2010 Paolo Ribeca <paolo.ribeca@gmail.com> ************************************************************************ * WARNING: this is a beta version, provided for testing purposes only; * * check for updates at <http://www.paoloribeca.net/software/GEM>. * ************************************************************************ Thu Nov 4 12:46:54 2010 -- Loading index (likely to take long)... done. Thu Nov 4 12:46:58 2010 -- Loading locations... done. Thu Nov 4 12:46:58 2010 -- Pre-scanning input file... done -- (FASTQ, it contains 35736809 reads). Thu Nov 4 12:48:47 2010 -- #0 sequences processed Thu Nov 4 12:48:52 2010 -- #10000 sequences processed Thu Nov 4 12:48:57 2010 -- #20000 sequences processed (...) Thu Nov 4 17:37:57 2010 -- #35690000 sequences processed Thu Nov 4 17:38:02 2010 -- #35700000 sequences processed Thu Nov 4 17:38:06 2010 -- #35710000 sequences processed Thu Nov 4 17:38:11 2010 -- #35720000 sequences processed Thu Nov 4 17:38:15 2010 -- #35730000 sequences processed Thu Nov 4 17:38:18 2010 -- #35736809 sequences processed