User:Maria Esposito/Notebook/Biology 210 at AU: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
Line 11: Line 11:
-Using this website to decode the sequence: [http://blast.ncbi.nlm.nih.gov/Blast.cgi]
-Using this website to decode the sequence: [http://blast.ncbi.nlm.nih.gov/Blast.cgi]


*Data and Observations*  
*<u>Data and Observations</u>*  


-The 16S PCR product was these two sequences:  
-The 16S PCR product was these two sequences:  

Revision as of 16:25, 28 February 2015

2.25.15- 16S Sequencing

  • Purpose: The purpose of this lab was to identify the species of the bacteria in our transect.
  • Materials and Methods:

-Run the PCR products through an agarose gel

-If there is a PCR product, the DNA will need to be purified for sequencing.

-Using this website to decode the sequence: [1]

  • Data and Observations*

-The 16S PCR product was these two sequences:

-NNNNNNNNNNNNNCNTANNNNGCAGTCGNNNGGTNGTAGANNGTTACNGATCTTGAGAGCGGCGTACGGGTGAGGAACAC GTGTGCAACCGGCCTTTCGCGGGGGGATACCCTTTCGAAGGGAAGATTAAAACCCCAAAAAACTGAGGATGGCATCTCTT GATATGGAAAACTCCGGTGGANAAAGATGGGCCCGCCCATGATTATATAGTTGGTANGGTAACGGCCTACCANGTCTGTG ATGTTTGTGGGGCCTGAGAGGGTGATCCCCCACTGTGGTACTGAGACACTGACCANACTCCTACGGGAGGCGCCTGTGAG GAATATTGGACAATGGGTGAGAGCCTGATCCAGCCGTCCCGCGTGAAGGATGACGGCCCTATGGGTTGTATACTTCTTTT GTATATGGATAAACCTTTCCTCATGTGGAAAGCTGAAGGTACTATACNAATAATCACCGGCTAACTCCTTGCCTTCAGCC TCGGTAATACNGANGGTGCTGCGTTATCCAGATTTATTGGNTTTAAAGGGTCCGTANGCGGATCTGTAANTCAATGGTGA AATCTTACTNCTTAACTGTCAAACTGCCATTGTTGCTGCAGGTCTTGANTATTGTATAACTANCTGGAATAATTANTCNA ACGGNNGNATGCATANNTAANNNTTAGAACACCAATTGCNAAGGCAGGTTACTATGTCTTANCTGACGCTNATGGACNAN NCGTGGGGAGCGAACAGGATTANATACCCTGNTANTCCACGCCNTANACGATGCTNACTNNTTTTGNNTCTTCNNATTCA GANACTAANNAAANTNATNAGTTAGCCNNCTNGCNNNNTANNTTCNCANNATGAAACTCNNAGNANTTGACGGGGNGCCC GCGCANNCGCTNGATTATGTGNTTTANTTNNNTTNNACGCGANNANNCTNNNNAACNCTTAANTNNNNATNNGAGCGGNT TNAGNNNTNNNNNNNNNATNANNNNATGTTCANNNTNCTNCNNNGNTNNNNGTGNGGNNNNNGTGCCCTGANNNNNNAGN NNNNNNTTNNNGNNNCAANNNNGNNNNNNNNNNNN

-NNNNNNNNNNNNNCNANNNNNGCAGCCGAGCGGTAGGTTTCCTTCGGGAGACTGAGAGCGGCGCACGGGTGCGGAACACG TGTGCAACCTGCCTTTATCAGGGGGATAGCCTTTCGAAAGGAAGATTAATACCCCATAATATTTTAAGTGGCATCACTTG AAATTGAAAACTCCGGTGGATAAAGATGGGCACGCGCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCTACGA TCTTTAGGGGGCCTGAGAGGGTGATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTGAGG AATATTGGACAATGGGTGAGAGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCTTTTG TATAGGGATAAACCTAGATACGTGTATCTAGCTGAAGGTACTATACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCG CGGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGATCTGTAAGTCAGTGGTGA AATCTCACAGCTCAACTGTGAAACTGCCATTGATACTGCAGGTCTTGAGTGTTGTTGAAGTAGCTGGAATAAGTAGTGTA GCGGTGAAATGCATAGATATTACTTAGAACACCAATTGCGAAGGCAGGTTACTAAGCAACAACTGACGCTGATGGACGAA AGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTNNCGATGCTAACTCGTTTTTGGGGCCTTGGCTTC AGAGACTAAGCGAAAGTGATAAGTTAGCCACCTGGGGAGTACGGACGCAAGTCTGAAACTCAAAGGAATTGACGGGGGCC CGCACAAGCGGTGGATTATGTGGTTTAATTCNATGATACGCGAGGAANCTTACCANGCTTAAATGGGAAATGACNNGGTT TNNNANNNNACNTTTCTTCGNCATTTTTCANNTGCTGCATGGNNGTCGTCNGCTCNTNNC

-Both of these sequences are identified as Chryseobacterium.

  • Conclusion: The bacteria identified as Chryseobacterium is gram negative and resistant to antibiotics. These results coincide with the gram negative characteristics of the agar plates.
  • Citation: Bentley, M., Walters-Conte, K., and Nancy K. Zeller. 2015. A Laboratory Manual to Accompany: General Biology II. Department of Biology, American University: Washington D.C.

M.E.

2.11.15--The Importance of Invertebrates in my Transect

  • Purpose:

For this lab, the purpose was to examine invertebrates from our transect with the berlese funnel. Our goal was to find five invertebrates within our transect and describe the organism, the length, and identify the class and phylum of the invertebrates.

  • Materials and Methods:

- Two petri dishes

- A dissecting microscope

- A pipette

- Key to identify invertebrates


1. Label one petri dish "top" and one "bottom". Pour 10-15 mLs of liquid containing organisms from the conical tube into the petri dish labelled "top".

2. Pour the remaining liquid into the petri dish labelled "bottom".

3. Examine five organisms with a dissecting microscope.

4. Identify the five organisms using the invertebrate key.

5. Then, observe the length, what the organism looks like, and whether it was from the top or bottom petri dish.


Image 1:

[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script> ]]


-This was the key used to identify organisms within in my transect


Table 1:

[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]


-This table shows the description and identification of our transect's tnvertebrates.


  • Conclusions and Future Directions:

From Table 1, it shows that organisms from the "top" petri dish had wings and two to four legs. While, the "bottom" petri dish were more wormlike and slender.


  • Citations:Bentley, M., Walters-Conte, K., and Nancy K. Zeller. 2015. A Laboratory Manual to Accompany: General Biology II. Department of Biology, American University: Washington D.C.


M.E.


2.4.15--The Characteristics and Importance of Plantae and Fungi

  • Purpose:

The purpose of this lab was to understand the characteristics and diversity of plantae and fungi. The samples we take from our transect are described through their size, shape, vascularization, specialized structures, and mechanisms of reproduction. Also, in this lab, my group made a Berlese funnel for next class to observe and collect invertebrates. My hypothesis is that my transect will have more vascular bundles in a ring than in bundles scattered out of the five leaf samples.

  • Materials and Methods:

-Three ziploc bags

-500 grams of leaf litter sample

-25 ml of ethanol/water solution

-50 ml conical tube

-Piece of screening material

-A funnel

-A ring stand

-A flask

-Parafilm

-A lamp

-Foil

- A razor

1. We retrieved a leaf litter sample and five leaf samples from our transect in ziploc bags.

2. Then, we examined each of our five leaf samples by doing a cross section with a razor to examine vascularization.

3. Next, we created our own Berlese funnel by pouring 50/50 ethanol/water solution into a 50 ml conical tube.

4. We taped a piece of screening material into the bottom of the funnel. Then, we placed the leaf litter sample into the top of the funnel.

5. We put the funnel into the ring stand setup. And wrapped the parafilm around the bottom of the funnel and the top of the tube.

6. Lastly, we placed a 40 watt lamp above the funnel. And then covered with foil.

  • Data and Observations:

-Table 1: Five Leaf Samples' Descriptions

[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]


-This table describes the shape, size, vascularization, and specialized structures.

-Also, the 1st and 2nd plants were the about the same in size. However, the first plant is not considered a sucker since the 2nd was found attached to the branch of a tree on a different angle.

-The first three plant samples looked very similar and could be assumed that it is a variation of the same species. The last two looked very different from the first three.


  • Conclusions and Future Directions:

My hypothesis is disproved since three out of five of my leaf samples had bundles scattered than bundles in a ring. Also, my group did not find any seeds or flowers in our transect. Therefore, we could not observe whether a leaf was a monocot or docot based on a single or double cotyledon.

  • Citations:Bentley, M., Walters-Conte, K., and Nancy K. Zeller. 2015. A Laboratory Manual to Accompany: General Biology II. Department of Biology, American University: Washington D.C.

M.E.


1.28.15--Microbiology and Identifying Bacteria with DNA sequences

  • Purpose:

The purpose of this lab was to understand the characteristics of bacteria, observe antibiotic resistance and the process of how DNA sequences are used to identify species from the Hay Infusion culture. With my group's agar plates, we will determine whether our plates are gram positive/gram negative and the cell description of each plate. My hypothesis is that the normal agar plates will have more colonies and be gram positive when compared to the agar-tetracycline plates.

  • Materials and Methods:

- Agar plates with serial dilutions (with tetracycline and normal nutrient)

- A microscope

- A loop

- A bunsen burner

- Staining tray

- A wash bottle

- Stains (Iodine, Safranin, Crystal Violet)

- Kimwipe

- Oil Immersion

- A centrifuge

- PCR/Primers

- 5 ul of supernatant


1. My group and I observed the growth on the agar plates, and recorded the number of colonies on each plate.

2. Then, we sterilized a loop over a flame. And added a drop of water on each slide.

3. Each of us scraped a tiny amount of growth from plates: 10^-3 and 10^-9 and 10^-3 and 10^-9 with tetracycline. And labeled the sample.

4. After, we dried the four slides by passing it through the flame.

5. Using a staining tray, we covered the bacterial smear with crystal violet for 30 seconds. Then, rinsed off the stain with a wash bottle of water. And blotted the slide with a kimwipe.

6. We repeated step #5 with Gram's iodine for 30 seconds and then, safranin for 20 seconds.

7. After air drying the slides, we used the 100x objective with oil immersion.

8. Next, we recorded the rest of the data on Table 2 by observing the stained slides.

9. We selected plates 10^-9 and 10^-9 with tetracycline to perform PCR.

10. We transferred a single colony from both plates; 10^-9 and 10^-9 with tetracycline to 100 ul of water in a tube.

11. We then incubated at 100 degrees for 10 minutes in a heat block. Then, centrifuged samples for 5 minutes each at 13,400 rpm.

12. While the tubes were centrifuging, we added 20 ul of primer. Then, mixed the tube to dissolve the PCR bead.

13. Lastly, we added 5 ul of supernatant from own centrifuged samples to the 16S PCR reaction. And placed the tubes into the PCR machine.


  • Data and Observations:

My Hay Infusion Culture Appearance-

Image 1 (Side View): [[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]

Image 2 (Above view): [[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]


-As seen in Image 1 and 2, a thick layer of a brown substance has formed on top of the Hay Infusion Culture. Under that layer, the water is murky but clearer than last week. Also, you can assume that an organism is present on some of the leaves.


My Agar Plates (normal and tetracycline):


Plate 10^-3 (w/o tet): [[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]

Plate 10^-3 (with tet): [[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]

Plate 10^-9 (w/o tet):[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]

Plate 10^-9 (with tet):[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]


-My group and I compared these two serial dilutions above, according to number of colonies, morphology and whether the bacteria was gram positive or negative.


Table 1: 100-fold Serial Dilutions Results

[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]


-This table shows how my group estimated the number of colonies per ml for each plate.


Table 2: Bacteria Characterization

[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]


-This table contains whether the colony was gram positive or gram negative, the colonies description, and the morphology of the bacteria.


  • Conclusions and Future Directions:

My hypothesis was partially correct because the normal agar plates did have more colonies than the tetracycline plates. According to my data in Table 2, the normal agar plates contained bacteria that were both gram positive and negative, not only positive. In addition, the bacteria that grew in the presence of tetracycline were resistance to tetracycline, and fewer colonies grew on these plates. In this lab, my group and I made a few mistakes:the bead popped out of the tube when transferring the supernatant, one of the agar plates became broken when removing tape, and it was difficult to label the PCR tubes.

  • Citations:Bentley, M., Walters-Conte, K., and Nancy K. Zeller. 2015. A Laboratory Manual to Accompany: General Biology II. Department of Biology, American University: Washington D.C.


M.E.


1.21.15--Identifying Algae and Protists from Different Niches of the Transect

  • Purpose:

For this lab, the purpose was to identify six organisms in our Hay Infusion culture by using the dichotomous key. My hypothesis from the previous lab was that my transect will be more abundant with protists than algae. During this lab, I will continue to test this hypothesis.

  • Materials and Methods:

-Prepared slides of Hay Infusion Culture from the bottom and top niches.

-Microscope

-Dichotomous Key

-Pipette


1. Make six wet mount slides of organisms from the two niches: 3 from the top niche and 3 from the bottom niche.

2. Observe organism at objectives 4X, 10X, and 40X.

3. Use dichotomous key to identify organism.


  • Data and Observations:

Hay Infusion Culture Description-

smell-->musky, foul, rotten mold on top looks murky and green water tinged brown


Descriptions of Organisms and Identification-

Note: Organism 1 to 3 are from the bottom niche of the jar. Organisms 4 to 6 are from the top niche of the jar.


First organism-Transparent, one long whip-like flagella, single cell motile, ~60 um

Second organism-kidney-bean shaped, bubble looking cells inside, spins

Third organism-seaweed looking

Fourth organism-almost circular, white ovals moving inside, colorless

Fifth organism-packman like face, spins, colorless

Sixth organism-peapod shape, long and thin


Figure 1-[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]

Figure 2-[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script> ]]

Figure 3-[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]

Figure 4-[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]

Figure 5-[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]

Figure 6-[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script> ]]


Figure 1. This is a picture of what we identified as Algae.

Figure 2. This is a picture of what we identified as Gonium.

Figure 3. This is a picture of what we identified as Peranema.

Figure 4. This is a picture of what we identified as Didinium Cyst.

Figure 5. This is a picture of what we identified as Colpidium.

Figure 6. This is a picture of what we identified as Euglena.


  • Conclusions and Future Directions

My group was uncertain if we identified our six organisms correctly. And it was difficult to take a picture of Figure 3 and is not a clear picture of that organism. With further examination, it looks like the second and fifth organisms are the same organism, Gonium. The third organism may have been identified incorrectly as algae, since my group assumed it looked like algae. My hypothesis has been disproved because there was more bacteria than protists in my transect, furthermore, only two out of six organisms were identified as protists and the other four were bacteria.

  • Citations:Bentley, M., Walters-Conte, K., and Nancy K. Zeller. 2015. A Laboratory Manual to Accompany: General Biology II. Department of Biology, American University: Washington D.C.


M.E.


1.14.15--Biological Life at AU: Observations of a Transect

  • Purpose:

At American University, I am observing Transect 3 (Tall brushes) to understand and identify the organisms that inhabit that area and the abiotic and biotic factors that affect that niche. My hypothesis is that the transect will be more abundant with protists than bacteria. We cannot tell which is more abundant in our transect, an Hay Infusion culture will be made to test this and observations with a microscope need to be made.

  • Materials and Methods:

-Scientific Microscope

-Sample of my transect

-50 mL conical tube

-0.1 gm of dried milk

-Plastic Jar

-500 mLs of deerpark water

-Graduated cylinder

1. Have a 20 x 20 meter transect to study and observe. Record the abiotic and biotic properties this transect.

2. Use a 50 mL conical tube to take a soil/vegetation sample of the transect.

3. Measure 500 mLs of deerpark water with a graduated cylinder. And place it in the plastic jar.

4. Then, add 12 grams of the transect sample and 0.1 gm of dried milk in the plastic jar.

5. Mix the contents for 10 seconds

6. Place the jar in a lab area. Label the jar and remove the lid.

  • Data and Observations:

Description of Transect- My group's transect (Tall Bushes) was a 20 x 20 meter section of land located in between Bender arena and the Amphitheater, and contained mostly bushes and leaves.

The abiotic factors:

  • snow
  • dirt
  • water
  • metal post
  • concrete

The biotic factors:

  • leaves
  • bushes
  • grass

Figure 1-[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]

Figure 2-[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script>]]

Figure 3-[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script> ]]

Figure 4-[[Image:

<script async src="//platform.twitter.com/widgets.js" charset="utf-8"></script> ]]

Figure 1.This is an drawing of our transect (tall brushes) from an aerial view and is labeled with abiotic and biotic factors.

Figure 2.This is a Google image of an aerial view of our transect.

Figure 3.This is an side view of our Hay Infusion culture.

Figure 4.This is an above view of our Hay Infusion culture.

  • Conclusions and Future Directions:

This data from transect does not support or disprove my hypothesis, I am unsure about what specific organisms are in my transect. Next lab period, further examination of the incubated Hay Infusion culture will be done.

  • Citations:Bentley, M., Walters-Conte, K., and Nancy K. Zeller. 2015. A Laboratory Manual to Accompany: General Biology II. Department of Biology, American University: Washington D.C.

M.E.

Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Maria_Esposito/Notebook/Biology_210_at_AU&oldid=869151"