User:Mariana Ruiz Velasco L./Notebook/IGEM 2010/Wet lab journal/2010/04/16: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 8: Line 8:
==Designing primers to induce a mutation in luciferase sequence (BBa_I712019)==
==Designing primers to induce a mutation in luciferase sequence (BBa_I712019)==


* As BBa_I712019 has a green emission spectrum, but we want a red one, the sequence requires a S851T (serine to threonine). mutation. To do that we need to design a PCR that will help with this change by using a specific primer:
 
5’ 3’ (Forward): AAGATTCAAACTGCGCTGCTGG
* As BBa_I712019 has a green emission spectrum, but we want a red one, the sequence requires a S851T (serine to threonine) mutation. To do that we need to design a PCR that will help with this change by using a specific primer:
 
 
*Forward:
5’ --> 3’: AAGATTCAAA''C''TGCGCTGCTGG
 
 
With a GC content of 50%, Tm = 66°C, and 22 nt. The sequence starts at position 841 to 862 of BBa_I712019 as registry’s id.  
With a GC content of 50%, Tm = 66°C, and 22 nt. The sequence starts at position 841 to 862 of BBa_I712019 as registry’s id.  
The experiment describes that, in order to induce this mutation, the sequence must be amplified from this point up to the 3’ extreme and must also share its complementary sequence (also a primer) and will amplify from that region to the 5’ extreme.   
The experiment describes that, in order to induce this mutation, the sequence must be amplified from this point up to the 3’ extreme and must also share its complementary sequence (also a primer) and will amplify from that region to the 5’ extreme.   
*Reverse:
5’ --> 3’: CCAGCAGCGCA''G''TTTGAATCTT   
*The experiment is explained with the next illustration:




Revision as of 09:01, 7 June 2010

Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Designing primers to induce a mutation in luciferase sequence (BBa_I712019)

  • As BBa_I712019 has a green emission spectrum, but we want a red one, the sequence requires a S851T (serine to threonine) mutation. To do that we need to design a PCR that will help with this change by using a specific primer:


  • Forward:

5’ --> 3’: AAGATTCAAACTGCGCTGCTGG


With a GC content of 50%, Tm = 66°C, and 22 nt. The sequence starts at position 841 to 862 of BBa_I712019 as registry’s id. The experiment describes that, in order to induce this mutation, the sequence must be amplified from this point up to the 3’ extreme and must also share its complementary sequence (also a primer) and will amplify from that region to the 5’ extreme.


  • Reverse:

5’ --> 3’: CCAGCAGCGCAGTTTGAATCTT


  • The experiment is explained with the next illustration:



Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Mariana_Ruiz_Velasco_L./Notebook/IGEM_2010/Wet_lab_journal/2010/04/16&oldid=419985"