User:Mariana Ruiz Velasco L./Notebook/IGEM 2010/Wet lab journal/2010/04/16: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 9: Line 9:


<br />
<br />
* As [[http://partsregistry.org/Part:BBa_I712019| BBa_I712019]] has a green emission spectrum, but we want a red one, the sequence requires a S851T (serine to threonine) mutation. To do that we need to design a PCR that will help with this change by using a specific primer:
* As [http://partsregistry.org/Part:BBa_I712019| BBa_I712019] has a green emission spectrum, but we want a red one, the sequence requires a S851T (serine to threonine) mutation. To do that we need to design a PCR that will help with this change by using a specific primer:




Revision as of 13:21, 7 June 2010

Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Designing primers to induce a mutation in luciferase sequence (BBa_I712019)


  • As BBa_I712019 has a green emission spectrum, but we want a red one, the sequence requires a S851T (serine to threonine) mutation. To do that we need to design a PCR that will help with this change by using a specific primer:


  • Forward:

5’ --> 3’: AAGATTCAAACTGCGCTGCTGG


With a GC content of 50%, Tm = 66°C, and 22 nt. The sequence starts at position 841 to 862 of BBa_I712019 as registry’s id. The experiment describes that, in order to induce this mutation, the sequence must be amplified from this point up to the 3’ extreme and must also share its complementary sequence (also a primer) and will amplify from that region to the 5’ extreme.


  • Reverse:

5’ --> 3’: CCAGCAGCGCAGTTTGAATCTT


  • The experiment is explained with the next illustration:

  • The blue square represents the site of mutation, while the purple rectangles represent the sequence. Arrows indicate the place where the primers must be and the orientation of the PCR.


  • After both sequences are amplified, DNA polymerase will be added so that the PCR products are completed. Finally, a PCR reaction must be done using only the orange-arrowed primers so that the product provides us with the complete sequence.

Defosfating restrictions


  • Continuing with the experiment, I defosfated restrictions of plasmids 17, 18 (jorge), 18 and 30. The reaction was as follows for a total of 30μL.


-H20 ----------> 11μL
-Buffer -------> 3μL
-DNA ----------> 15μL
-Defosfatase --> 1μL


  • The reaction was incubated at 37°C for 15 min. and at 65°C for 5 min to inactivate the enzyme.


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Mariana_Ruiz_Velasco_L./Notebook/IGEM_2010/Wet_lab_journal/2010/04/16&oldid=420233"