User:Mariana Ruiz Velasco L./Notebook/IGEM 2010/Wet lab journal/2010/04/16: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 34: Line 34:
<br />
<br />


==Defosfating restrictions==
<br/ >
* Continuing with the experiment, I defosfated restrictions of plasmids 17, 18 (jorge), 18 and 30. The reaction was as follows for a total of 30μL.
<br/ >
-H20 ----------> 11μL<br/ >
-Buffer ------->  3μL<br/ >
-DNA ----------> 15μL<br/ >
-Defosfatase -->  1μL<br/ >


*The reaction was incubated at 37°C for 15 min. and at 65°C for 5 min to inactivate the enzyme.


<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->

Revision as of 18:07, 13 August 2010

WiFi coli: A communi-colight system <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Designing primers to induce a mutation in luciferase sequence (BBa_I712019)


  • As BBa_I712019 has a green emission spectrum, but we want a red one, the sequence requires a mutation which, according to Bruce R. Branchini, et al.("Thermostable red and green light-producing firefly luciferase mutants for bioluminescent reporter applications", 2007), is reported as S284T (also known as S851T). To do that, we decided to do a punctual mutation, where we need to design a PCR that will help with this change by using a specific primer where the nucleotide which is supposed to change is indicated in a bold letter.



  • Forward:

5’ --> 3’: AAGATTCAAACTGCGCTGCTGG


With a GC content of 50%, Tm = 66°C, and 22 nt. The sequence starts at position 841 to 862 of BBa_I712019 as registry’s id. The experiment describes that, in order to induce this mutation, the sequence must be amplified from this point up to the 3’ extreme and must also share its complementary sequence (also a primer) and will amplify from that region to the 5’ extreme.


  • Reverse:

5’ --> 3’: CCAGCAGCGCAGTTTGAATCTT


  • The experiment is explained with the next illustration:



  • The blue square represents the site of mutation, while the purple rectangles represent the sequence. Arrows indicate the place where the primers must be and the orientation of the PCR.



  • After both sequences are amplified, DNA polymerase will be added so that the PCR products are completed. Finally, a PCR reaction must be done using only the orange-arrowed primers so that the product provides us with the complete sequence.




Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Mariana_Ruiz_Velasco_L./Notebook/IGEM_2010/Wet_lab_journal/2010/04/16&oldid=444689"