User:Mbennie/Notebook/Oligos/Mut2 Pst1b-F

From OpenWetWare
< User:Mbennie‎ | Notebook‎ | Oligos
Revision as of 12:46, 15 August 2007 by Mbennie (talk | contribs) (New page: Sequence: gctcttcagctgcttactttgccaattatggcaa Binding site: 23 bp Predicted Tm: 55.2C Received: 8/15/2007 * Resuspended at 50uM with 477.2ul of TE)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

Sequence: gctcttcagctgcttactttgccaattatggcaa

Binding site: 23 bp

Predicted Tm: 55.2C

Received: 8/15/2007

  • Resuspended at 50uM with 477.2ul of TE
Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Mbennie/Notebook/Oligos/Mut2_Pst1b-F&oldid=141400"