User:Meng Xiao He/Notebook/fall08/2008/11/17: Difference between revisions

From OpenWetWare
< User:Meng Xiao He‎ | Notebook‎ | fall08‎ | 2008‎ | 11
Jump to navigationJump to search
Line 25: Line 25:
* No colonies on plates
* No colonies on plates
* No growth in liquid cultures (rinsed SOC tube w/ LB and grew up in LB-Gm)
* No growth in liquid cultures (rinsed SOC tube w/ LB and grew up in LB-Gm)




<!-- end -->
<!-- end -->
|}
|}

Revision as of 12:47, 18 November 2008

<html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Sequence results

  • cco flank: pER21+C1 is correct, as is TOPO A
  • Duo flank: pUC19 containing is current, but TOPO C IS NOT (contains only part of flank)
  • cbb flank: pER21+B2 is correct
  • pER21 does seem to contain the M13 forward (-21/20) priming site, along with the EcoRI site next to it. The sequence that matches w/ pUC19:
TACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCC
TGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGT
AATAGCGAAGAGGCCCGCACCGATCGCC


All sequencing could use more scrutiny, and are not complete.

Transformations into MR-1 failed

  • For each of 3 plasmids, tried normal protocol and different one with more cells and more DNA at 1.15 KV
  • No colonies on plates
  • No growth in liquid cultures (rinsed SOC tube w/ LB and grew up in LB-Gm)


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Meng_Xiao_He/Notebook/fall08/2008/11/17&oldid=263157"