User:Nkuldell/SAGA swap pt 2

From OpenWetWare

< User:Nkuldell(Difference between revisions)
Jump to: navigation, search
(Phenotype wt vs sgf73 vs sgf29 vs double)
Current revision (14:13, 15 September 2006) (view source)
(<b> BBa_Y00029</b> [])
(One intermediate revision not shown.)
Line 5: Line 5:
===<b> BBa_Y00073 </b>[] ===
===<b> BBa_Y00073 </b>[] ===
had DNA 2.0 codon-optimize S. pombe gene SPCC126.04c [[]]
had DNA 2.0 codon-optimize S. pombe gene SPCC126.04c [[]]
including biobrick ends for expression of ORF in S. cerevisiae
[[]]including biobrick ends for expression of ORF in S. cerevisiae
This subunit is homolog of S. cerevisiae SGF73 [[]] subunit of SAGA and deletion of this subunit in S. cerevisiae results in viable cells but no induction of PAU genes under hypoxic conditions.
This subunit is homolog of S. cerevisiae SGF73 [[]] subunit of SAGA and deletion of this subunit in S. cerevisiae results in viable cells but no induction of PAU genes under hypoxic conditions.
===<b> BBa_Y00029</b> []===
===<b> BBa_Y00029</b> []===
Message to DNA 2.0:
Message to DNA 2.0:
<br>The gene is an S. pombe gene called SPBC1921.07c. The protein sequence is:
<br>The gene is an S. pombe gene called SPBC1921.07c [[]]. The protein sequence is:
mvrpinaeed vtsmwvkfhe slnpirssli kqeecyktvd gddnpieeri kacdagiqts
mvrpinaeed vtsmwvkfhe slnpirssli kqeecyktvd gddnpieeri kacdagiqts
Line 23: Line 23:
optimized the cloning sites can be added by tagging the 5' end before  
optimized the cloning sites can be added by tagging the 5' end before  

Current revision


DNA Reagents

Codon Usage Comparison using GeneArt tool called Graphical Codon Usage Analyzer [1]. Output show on SAGA swap discussion page [[2]]

BBa_Y00073 [3]

had DNA 2.0 codon-optimize S. pombe gene SPCC126.04c [[4]] [[5]]including biobrick ends for expression of ORF in S. cerevisiae This subunit is homolog of S. cerevisiae SGF73 [[6]] subunit of SAGA and deletion of this subunit in S. cerevisiae results in viable cells but no induction of PAU genes under hypoxic conditions.

BBa_Y00029 [7]

Message to DNA 2.0:
The gene is an S. pombe gene called SPBC1921.07c [[8]]. The protein sequence is:
mvrpinaeed vtsmwvkfhe slnpirssli kqeecyktvd gddnpieeri kacdagiqts eeqkkeleht mqslemiinv lekanekpvi tnspltrsrr nrgtsftant vtftpgmsva fklpytrhne ggdwiqciii kvtgegakqr fevqdpepdd dgnagqiykt tanhliqipa kgtplppisp ktnvlarype tttfyraevi rtlpdgsckl rfegeeevgk etvverhlvl eyng stop

What I'd like to try is to codon optimize this protein for expression in S. cerevisiae (nuclear expression, not mitochondrial as before!). Again this ORF can have none of the "forbidden" sites (EcoRI, XbaI, NotI, SpeI or PstI ) that are used for cloning. Once it's been optimized the cloning sites can be added by tagging the 5' end before the ATG with: GTTTCTTCGAATTCGCGGCCGCTTCTAGAG and tagging the 3' end after the stop with: TACTAGTAGCGGCCGCTGCAGGAAGAAAC.


  • sgf73::KanMX_KO_fwd (JW109)
  • sgf73::KanMX_KO_rev (JW110)
  • sgf73_URA3_KO_fwd (NO99)
  • sgf73_URA3_KO_rev (NO100)
  • sgf29_URA3_KO_fwd (NO101)
  • sgf29_URA3_KO_rev (NO102)
  • SGF73_100upstm_fwd (NO107)
  • SGF73_100dwstm_rev (NO108)
  • SGF29_100upstm_fwd (NO109)
  • SGF29_100dwstm_rev (NO110)
  • URA3_464bpDwstATG_fwd (FO3672 =MH243) Tm 58.8
  • URA3_638bpDwstATG_rev (FO3673 =MH244) Tm 55
  • SpSGF73*toSc_fwd (where * indicates codon optimized version of the Sp homolog of the Sc SGF73) (NO111)
    • landing seq has Tm of 50°
  • SpSGF73*toSc_rev (NO112)
    • landing seq has Tm of 55°
    • dangit. primer's proper sequence should be:5' CTCACTTCGTGAACATGCTGGATAACGTGCATGATTCAAttacagaggttgacgggct
      (ordered and logged as NO113)
      this glitch changes last 5 residues from ARQPL* to ARQAL*
  • SpSGF73toSc_fwd (to amplify Sp genomic sequence for SPCC126.04c = Sc homolog of Sc SGF73) (NO114)
    • landing seq has Tm of 46.3°
  • SpSGF73toSc_rev (NO115)
    • landing seq has Tm of 56.7°
  • SpSGF29toSc_fwd (to amplify Sp genomic sequence for SPBC1921.07c = Sc homolog of Sc SGF29) (NO116)
    • third base should be G not C (fixed on extending oligo "upstmSGF29_150bp_fwd")
    • landing seq has Tm of 52.5°
  • SpSGF29toSc_rev (NO117)
    • landing seq has Tm of 43.7°
  • SpSGF29ck_rev (NO119)
    • use with NO109 to confirm sequence from pombe is in cerevisiae, expecting 821bp product
    • binds 3' end of Sp homolog of SGF29
  • SpSGF29ck_fwd (NO118)
    • use with NO110 to confirm sequence from pombe is in cerevisiae, expecting 821bp product
    • binds 5' end of Sp homolog of SGF29
  • SpSGF29*toSc_fwd (where * indicates codon optimized version of Sp homolog of the Sc SGF29) (NO120)
    • third base should be G not C (fixed on extending oligo "upstmSGF29_150bp_fwd")
    • landing seq has Tm of 46.9°
  • SpSGF29*toSc_rev (NO121)
    • landing seq has Tm of 43.2 °
  • upstmSGF73_150bp_fwd (NO122)
    • 5'- TAA TTT ACC AAA ACG GAA TAA ACC AAA AAA ATA AGA ATA Gtg aac aca caa gag aag cgc
    • if used on PCR product of NO111 or NO114 then Tm of landing is 55.8°
  • dwstmSGF73_150bp_rev (NO123)
    • 5'- TAG ACG TGT ACA TGT TAC TTC GGC GAA TAA TTT TTT ATT Act cac ttc gtg aac atg ctg
    • if used on PCR product of NO112, NO113 or NO115 then Tm of landing is 53.9°
  • upstmSGF29_150bp_fwd (NO124)
    • 5'-GTT AAA GAC ACA ATA CCT TGG TGG CTT CTC TAA GTG GGG G gagtttttcacagcaaaaca
    • if used on PCR product of NO116 or NO120 then Tm of landing is 49.5°
  • dwstmSGF29_150bp_rev (NO125)
    • 5'- ATC ACT TCC GAC GAT ACC AAA ATA ATG ACA AAA TGC CAT G agaagatcttatgatatgta
    • if used on PCR product of NO117 or NO121 then Tm of landing is 42.0°
  • SpSGF73_ATG_fwd (NO126)
    • use with NO108 to confirm sequence from pombe is in cerevisiae
    • binds 5' end of Sp homolog of SGF73
    • 5'-atgttaacag aacaacagac tttggagtta
  • SpSGF73*_ATG_fwd (NO127)
    • use with NO108 to confirm sequence from pombe is in cerevisiae
    • binds 5' end of codon optimized version of Sp homolog of SGF73
  • SpSGF29*_ATG_fwd (NO128)
    • use with NO110 to confirm sequence from pombe is in cerevisiae
    • binds 5' end of codon optimized version of Sp homolog of SGF29

Yeast Strains

MH176=hypoxic gene expression reporter strain

from Mark Hickman in Fred's lab:
MATa ura3D0 his3D200 leu2D0 lys2-128d HAP1 DAN3-HIS3
geneology note: = yMH36 DAN3-HIS3 #5 (targeted PAU6, went into DAN3) 05/25/05

related email note 07.12.06 from Mark
I only have PAU5-URA3 or DAN3-HIS3. The DAN3 reporter is tighter on plates, perhaps because the His phenotype is tighter in general. I have not checked whether SGF73 is required for PAU5-URA3 or DAN3-HIS3 induction specifically. But I do know that in an sgf73 delta mutant, there is no hypoxic PAU expression. So I infer that PAU5 and DAN3 expression is affected. We can talk in the afternoon.

FY2475 = sgf73::KanMX K/O strain

made by Jenny in Fred's lab:
MAT alpha ura3-52 lys2-173R2 leu2D1 arg4-12 his4-917d sgf73D0::KanMX

FY2474 = sgf29::KanMX K/O strain

also by Jenny?
MAT A ura3-52 lys2-173R2 leu2D1 arg4-12 his4-917d sgf73D0::KanMX

NY350 and NY351

MATa ura3D0 his3D200 leu2D0 lys2-128d HAP1 DAN3-HIS3 sgf73::URA3

  • geneology: transformed MH176 to Ura+ with product of PCR with KO primers NO99 and NO100
  • Insertion confirmed by PCR using primers that flank the K/O (NO107, NO108) as well as flank+internal PCR (NO107, NO108, FO3672)
  • Phenotype checked for failure to induce DAN3-HIS3 fusion under hypoxic conditions.
    • only NY350 grew normally on plates with ergosterol and tween.
    • This was true for SC+ erg + tween and SC-his + erg +tween, under aerob and hypoxic conditions. Use ONLY NY350!!


MAT A ura3-52 lys2-173R2 leu2D1 arg4-12 his4-917d sgf73D0::URA3 sgf29::KanMX

  • geneology: transformed FY2474 to Ura+ with product of PCR with KO primers NO99 and NO100
  • Insertion confirmed by PCR using primers that flank the K/O (NO107, NO108) as well as flank + internal PCR (NO107, NO108, FO3672)

NY356 and NY357

MAT alpha ura3-52 lys2-173R2 leu2D1 arg4-12 his4-917d sgf29::URA3 sgf73D0::KanMX

  • geneology: transformed FY2475 to Ura+ with product of PCR with KO primers NO101 and NO102 using pRS406 as template.
  • gel purified frag for transformation
  • Insertion checked by PCR using primers internal +flanking K/O (NO109, NO110, FO3672)

Phenotype MH176 (~wt) v FY2475 (sgf73::KanMX) v FY2474 (sgf29::KanMX)

First spot where individual colonies seen is listed
Better wt control would be FY3 since FY strains are all hap1

Plate type Temp MH176 (~wt) FY2475 (sgf73::KanMX) FY2474 (sgf29::KanMX) comments
YPD 30° 3d 6 6 6 Mark has seen 73 KO grow more slowly doing growth curve
YPD 37° 3d 6 6 6
YPD 14° 4d 4 4 4
YPgal 30° 3d 6 4 (repeat this?) 6
YPgal 37° 3d 5 5 5
YPgal 14° 4d 2 2 2
YPKAc 30° 3d 5 5 5
YPKAc 37° 3d 5 5 5
YPKAc 14° 4d 4 4 4
YPEG 30° 3d 3-4 2-3 2-3
YPEG 37° 3d 2-3 1-2 1-2
YPEG 30° 4d 6 3 3-4
YPEG 37° 4d 3 2 2 greater diff. seen at 30° on YPEG

Phenotype wt vs sgf73 vs sgf29 vs double

First spot where individual colonies seen is listed
FY3, FY2475, FY2474 and NY356 all FY bkgd so hap1
MH176, NY350 in HAP1 bkgd and carry dan3::HIS3 reporter

Plate type Temp FY3 (~wt) MH176 (~wt) FY2475 (sgf73::KanMX) NY350 (sgf73::URA3 in MH176) FY2474 (sgf29::KanMX) FY356 (sgf29::URA3 sgf73::KanMX) comments
YPD 30° 4d 5-6 5-6 5-6 5-6 5-6 5-6 double mutant grows more slowly but same spot # comes up
YPD +1M NaCl 30° 4d 5 5 5-6 5-6 5-6 5-6 no NaCl p-type at 37° or 14° either
YPD +3% formamide 30° 4d 5-6 5-6 3-4 3-4 5-6 1 sgf73 alone has some sensitivity to formamide and sgf29, sgf73 has much greater sensitivity (sgf29 alone has ~no sensitivity). Can use this synthetic phenotype as well as 73 phenotype to look for complementation by pombe subunit (underway 08.02.06). Note: 37° and formamide suppresses the sgf73 phenotype but synthetic phenotype of double still evident. 14° and formamide had showed sensitivity for sgf73::KanMX but not sgf73::URA3...need to recheck this since v. strange.
YPEG 30° 4d 4-5 4-5 2-3 2-3 4-5 v little growth even on 1 effect mimics what is seen on YPD +3%formamide. Can use this for complementation tests as well. Not known why NFCS ~lethal to sgf73, sgf29 double mutant.
YPgal 30° 3d 5-6 5-6 4-5 4-5 5-6 3-4 result recapitulates what was seen before but effects not as dramatic as on YPD +3% formamide or YPEG

Phenotype wt vs sgf73 vs sgf29 vs double

1/10th txd PCR products
1/10th txd PCR products
Personal tools