User:Nkuldell/SAGA swap pt 2

From OpenWetWare

< User:Nkuldell
Revision as of 21:56, 20 July 2006 by Nkuldell (Talk | contribs)
Jump to: navigation, search

Contents

DNA Reagents

BBa_Y00073 [[1]]

had DNA 2.0 codon-optimize S. pombe gene SPCC126.04c [[2]] including biobrick ends for expression of ORF in S. cerevisiae This subunit is homolog of S. cerevisiae SGF73 [[3]] subunit of SAGA and deletion of this subunit in S. cerevisiae results in viable cells but no induction of PAU genes under hypoxic conditions.

Codon Usage Comparison using GeneArt tool called Graphical Codon Usage Analyzer [4]. Output show on SAGA swap discussion page [[5]]

Primers

  • sgf73::KanMX_KO_fwd (JW109)
    • 5' TGAACACACAAGAGAAGCGCAAAAGAGTAAAGAGCTAAA ctgtgcggtatttcacaccg
  • sgf73::KanMX_KO_rev (JW110)
    • 5' CTCACTTCGTGAACATGCTGGATAACGTGCATGATTCAA agattgtactgagagtgcac
  • sgf73_URA3_KO_fwd (NO99)
    • 5' TGAACACACAAGAGAAGCGCAAAAGAGTAAAGAGCTAAAatgtcgaaagctacatataa
  • sgf73_URA3_KO_rev (NO100)
    • 5' CTCACTTCGTGAACATGCTGGATAACGTGCATGATTCAA ttagttttgctggccgcatc
  • sgf29_URA3_KO_fwd (NO101)
    • 5' GACTTTTTCACAGCAAAACACACGGTCACCTTTCTTATTatgtcgaaagctacatataa
  • sgf29_URA3_KO_rev (NO102)
    • 5' AGAAGATCTTATGATATGTAGTAAATGTTAACCACCATTttagttttgctggccgcatc
  • SGF73_100upstm_fwd (NO107)
    • 5'- CCA GCA TCG CTC ATT AGA GAT TAA TTT
  • SGF73_100dwstm_rev (NO108)
    • 5'- GCG TAA CTT GTC CAC AAA CAT AGA CGT G
  • SGF29_100upstm_fwd (NO109)
    • 5'- CGA TTT TGC CAG ATA CGA AAA AGG TTA AAG AC
  • SGF29_100dwstm_rev (NO110)
    • 5'- CAC CTT CAA GTG AAT ACA TCA CTT CCG ACG
  • URA3_464bpDwstATG_fwd (FO3672 =MH243) Tm 58.8
    • 5'- GCAAGGGCTCCCTAGCTACT
  • URA3_638bpDwstATG_rev (FO3673 =MH244) Tm 55
    • 5'- AATGCGTCTCCCTTGTCATC
  • SpSGF73*toSc_fwd (where * indicates codon optimized version of the Sp homolog of the Sc SGF73)
    • 5' TGAACACACAAGAGAAGCGCAAAAGAGTAAAGAGCTAAAatgctaaccgaacaacaaa
    • landing seq has Tm of 50°
  • SpSGF73*toSc_rev
    • 5' CTCACTTCGTGAACATGCTGGATAACGTGCATGATTCAAttacagagcttgacgggct
    • landing seq has Tm of 55°
  • SpSGF73toSc_fwd (to amplify Sp genomic sequence for SPCC126.04c = Sc homolog of Sc SGF73)
    • 5' TGAACACACAAGAGAAGCGCAAAAGAGTAAAGAGCTAAAatggtacgcgggataaatg
    • landing seq has Tm of 52.5°
  • SpSGF73toSc_rev (to amplify Sp genomic sequence for SPCC126.04c = Sc homolog of Sc SGF73)
    • 5' CTCACTTCGTGAACATGCTGGATAACGTGCATGATTCAAttaaccattgtactctaac
    • landing seq has Tm of 43.7°

Yeast Strains

MH176=hypoxic gene expression reporter strain

from Mark Hickman in Fred's lab:
MATa ura3D0 his3D200 leu2D0 lys2-128d HAP1 DAN3-HIS3
geneology note: = yMH36 DAN3-HIS3 #5 (targeted PAU6, went into DAN3) 05/25/05

related email note 07.12.06 from Mark
Natalie,
I only have PAU5-URA3 or DAN3-HIS3. The DAN3 reporter is tighter on plates, perhaps because the His phenotype is tighter in general. I have not checked whether SGF73 is required for PAU5-URA3 or DAN3-HIS3 induction specifically. But I do know that in an sgf73 delta mutant, there is no hypoxic PAU expression. So I infer that PAU5 and DAN3 expression is affected. We can talk in the afternoon.
Mark

FY2475 = sgf73::KanMX K/O strain

made by Jenny in Fred's lab:
MAT alpha ura3-52 lys2-173R2 leu2D1 arg4-12 his4-917d sgf73D0::KanMX

FY2474 = sgf29::KanMX K/O strain

also by Jenny?
MAT A ura3-52 lys2-173R2 leu2D1 arg4-12 his4-917d sgf73D0::KanMX

NY350 and NY351

MATa ura3D0 his3D200 leu2D0 lys2-128d HAP1 DAN3-HIS3 sgf73::URA3 transformed MH176 to Ura+ with product of PCR with KO primers NO99 and NO100

NY352

MAT A ura3-52 lys2-173R2 leu2D1 arg4-12 his4-917d sgf73D0::KanMX sgf29::URA3 transformed FY2475 to Ura+ with product of PCR with KO primers NO99 and NO100

Phenotype MH176 (~wt) v FY2475 (sgf73::KanMX) v FY2474 (sgf29::KanMX)

First spot where individual colonies seen is listed
Better wt control would be FY3 since FY strains are all hap1

Plate type Temp MH176 (~wt) FY2475 (sgf73::KanMX) FY2474 (sgf29::KanMX) comments
YPD 30° 3d 6 6 6 Mark has seen 73 KO grow more slowly doing growth curve
YPD 37° 3d 6 6 6
YPD 14° 4d 4 4 4
YPgal 30° 3d 6 4 (repeat this?) 6
YPgal 37° 3d 5 5 5
YPgal 14° 4d 2 2 2
YPKAc 30° 3d 5 5 5
YPKAc 37° 3d 5 5 5
YPKAc 14° 4d 4 4 4
YPEG 30° 3d 3-4 2-3 2-3
YPEG 37° 3d 2-3 1-2 1-2
YPEG 30° 4d 6 3 3-4
YPEG 37° 4d 3 2 2 greater diff. seen at 30° on YPEG
Personal tools