User:Nkuldell/SAGA vs Swi/Snf: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
No edit summary |
||
(7 intermediate revisions by the same user not shown) | |||
Line 2: | Line 2: | ||
==SAGA subunits, <i> S. cerevisiae </i>== | ==SAGA subunits, <i> S. cerevisiae </i>== | ||
link to FW yeast strain collection [[http://genepath.med.harvard.edu/strainfinder/yeast.php]] <br> | most strains listed in Martens, Wu, Winston G&D paper 2005 [[http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Retrieve&dopt=AbstractPlus&list_uids=16291644&query_hl=10&itool=pubmed_docsum]] | ||
Parent strain for 109 deletion analysis: | <br>link to FW yeast strain collection [[http://genepath.med.harvard.edu/strainfinder/yeast.php]] <br> | ||
Parent strain for 109 deletion analysis: FY2068 = MAT(alpha) ura3-52 his3D200 leu2D1 lys2-128d | |||
{| border="1" | {| border="1" | ||
! Ada subunits | ! Ada subunits | ||
Line 11: | Line 12: | ||
|- | |- | ||
| Ada1 (aka HFI1, SUP110, SRM12, GAN1) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA1]] | | Ada1 (aka HFI1, SUP110, SRM12, GAN1) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA1]] | ||
| 1.467 kb/489 aa, | | 1.467 kb/489 aa, Chr. XVI, <br>viable | ||
| | | FY1560<br> aka NY383 | ||
| | | MAT(A) ura3-52 his3D200 lys2-173R2 <br> <b>ada1::HIS3</b> | ||
|- | |- | ||
| Ada2 (aka SWI8) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA2]] | | Ada2 (aka SWI8) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA2]] | ||
| 1.305 kb/434aa, | | 1.305 kb/434aa, Chr. IV, <br>viable | ||
| | | FY1548<br> aka NY384 | ||
| | | MAT(A) ura3-52 his3D200 leu2D1 lys2-128d <br> <b> ada2::HIS3 </b> | ||
|- | |- | ||
| Ada3 (aka NGG1, SWI7) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA3]] | | Ada3 (aka NGG1, SWI7) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA3]] | ||
| 2.109 kb/702aa, | | 2.109 kb/702aa, Chr. IV, <br>viable | ||
| | | FY1596<br> aka NY385 | ||
| | | MAT(A) ura3-52 his3D200 his4-912d lys2-173R2 <br> <b> ada3::HIS3 </b> | ||
|- | |- | ||
| Gcn5 (aka ADA4, SWI9) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=GCN5]] | | Gcn5 (aka ADA4, SWI9) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=GCN5]] | ||
| 1.32 kb/439aa, | | 1.32 kb/439aa, Chr. VII, <br>viable | ||
| | | FY1600<br> aka NY386 | ||
| | | MAT(A) ura3-52 leu2D1 his3D200 his4-917d <br> <b> gcn5::HIS3 </b> | ||
|- | |- | ||
| Ada5 (aka SPT20) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Ada5]] | | Ada5 (aka SPT20) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Ada5]] | ||
| 1.815 kb/604aa, | | 1.815 kb/604aa, Chr. XV, <br>viable | ||
| | | FY1098 | ||
| | | see spt20::URA3 | ||
|} | |} | ||
{| border="1" | {| border="1" | ||
Line 42: | Line 43: | ||
|- | |- | ||
| Spt3 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=spt3]] | | Spt3 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=spt3]] | ||
| 1.014 kb/337aa, | | 1.014 kb/337aa, Chr. IV, <br> viable | ||
| | | FY2142<br> aka NY387 | ||
| | | MAT (alpha) <br> <b> spt3::KanMX </b> | ||
|- | |- | ||
| Spt7 (aka GIT2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt7]] | | Spt7 (aka GIT2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt7]] | ||
| 3.999 kb/1332aa, | | 3.999 kb/1332aa, Chr. II, <br> viable | ||
| | | FY963<br> aka NY388 | ||
| | | MAT(A) ura3-52 his4-917d leu2d1 <br> <b> spt7::LEU2 </b> | ||
|- | |- | ||
| Spt8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt8]] | | Spt8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt8]] | ||
| 1.809 kb/602aa, | | 1.809 kb/602aa, Chr. XII, <br> viable | ||
| | | FY50<br> aka NY389 | ||
| | | MAT(A) ura3-52 his4-917d leu2d1 trp1d63 <br> <b>spt8d-302::LEU2 </b> | ||
|- | |- | ||
| Spt20 (aka Ada5) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SPT20]] | | Spt20 (aka Ada5) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SPT20]] | ||
| | | 1.815 kb/604aa, Chr. XV, <br> viable | ||
| | | FY1098<br> aka NY390 | ||
| | | MAT(A) ura3-52 his3d200 leu2d1 <br> <b>spt20d100::URA3 </b> | ||
|} | |} | ||
{| border="1" | {| border="1" | ||
! TAF subunits | ! TAF subunits | ||
! size, chromosome, null p-type | ! size, chromosome, null p-type | ||
|- | |- | ||
| TAF5 (aka TAF90) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF5]] | | TAF5 (aka TAF90) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF5]] | ||
| 2.397 kb/798aa, Chr. II, <font color = red>inviable</font color> | | 2.397 kb/798aa, Chr. II, <font color = red>inviable</font color> | ||
|- | |- | ||
| TAF6 (aka TAF60) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF6]] | | TAF6 (aka TAF60) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF6]] | ||
| 1.551 kb/516aa, Chr. VII, <font color = red>inviable</font color> | | 1.551 kb/516aa, Chr. VII, <font color = red>inviable</font color> | ||
|- | |- | ||
| TAF9 (aka TAF17) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF9]] | | TAF9 (aka TAF17) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF9]] | ||
| 0.474 kb/157aa, Chr. XIII, <font color = red>inviable</font color> | | 0.474 kb/157aa, Chr. XIII, <font color = red>inviable</font color> | ||
|- | |- | ||
| TAF10 (aka TAF23, TAF25) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF10]] | | TAF10 (aka TAF23, TAF25) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF10]] | ||
| 0.621 kb/206aa, Chr. IV, <font color = red>inviable</font color> | | 0.621 kb/206aa, Chr. IV, <font color = red>inviable</font color> | ||
|- | |- | ||
| TAF12 (aka TAF61, TAF68) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF12]] | | TAF12 (aka TAF61, TAF68) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF12]] | ||
| 1.620 kb/539aa, Chr. IV, <font color = red>inviable</font color> | | 1.620 kb/539aa, Chr. IV, <font color = red>inviable</font color> | ||
|} | |} | ||
{| border="1" | {| border="1" | ||
! Tra1 subunit | ! Tra1 subunit | ||
! size, chromosome, null p-type | ! size, chromosome, null p-type | ||
|- | |- | ||
| Tra1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TRA1]] | | Tra1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TRA1]] | ||
| 11.235 kb/3744aa, Chr. VIII, <font color = red>inviable</font color> | | 11.235 kb/3744aa, Chr. VIII, <font color = red>inviable</font color> | ||
|} | |} | ||
{| border="1" | {| border="1" | ||
Line 110: | Line 95: | ||
|- | |- | ||
| Sgf73 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf73]] | | Sgf73 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf73]] | ||
| 1.974 kb/657aa, Chr. VII , viable | | 1.974 kb/657aa, Chr. VII , <br> viable | ||
| | | NY350 | ||
| | | MAT(A) ura3D0 his3D200 leu2D0 lys2-128d HAP1 DAN3:HIS3 <br> <b> sgf73::URA3</b> | ||
|- | |- | ||
| Sgf29 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf29]] | | Sgf29 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf29]] | ||
| 0.779 kb/259aa, Chr. III, viable | | 0.779 kb/259aa, Chr. III, <br> viable | ||
| | | FY2474 | ||
| | | MAT(A) ura3-52 his4-917d leu2D1 lys2-173R2 arg4-12 <br> <b> sgf29D0::KanMX </b> | ||
|- | |- | ||
| Sgf11 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf11]] | | Sgf11 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf11]] | ||
| 0.3 kb/99aa, Chr.XVI, viable | | 0.3 kb/99aa, Chr.XVI, <br> viable | ||
| | | NY391 | ||
| | | MAT(A) ura3-52 his3D200 leu2D0 lys2-128d trp1-63 <br> <b> sgf11::KanMX </b> | ||
|- | |- | ||
| Ubp8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ubp8]] | | Ubp8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ubp8]] | ||
| 1.416 kb/471aa, Chr. XIII, viable | | 1.416 kb/471aa, Chr. XIII, <br> viable | ||
| | | FY2473 <br> aka NY392 | ||
| | | MAT(alpha) ura3-52 leu2D1 lys2-173R2 arg4-12 <br> <b>ubp8D0::KanMX </b> | ||
|- | |- | ||
| Sus1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Sus1]] | | Sus1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Sus1]] | ||
| gene with intron, Chr. II, viable | | gene with intron, Chr. II, <br> viable | ||
| | | | ||
| | | | ||
Line 141: | Line 126: | ||
|- | |- | ||
|SWII (aka ADR6, GAM3, LPA1)[[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=swi1]] | |SWII (aka ADR6, GAM3, LPA1)[[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=swi1]] | ||
|3945bp/1315 aa, Chr. XVI, <font color =red> inviable </font color> | |3945bp/1315 aa, Chr. XVI, <br> <font color =red> inviable </font color> | ||
|- | |- | ||
|SWI2 (aka GAM1, HAF1, <font color = red> SNF2 </font color>, TYE3)[[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SWI2]] | |SWI2 (aka GAM1, HAF1, <font color = red> SNF2 </font color>, TYE3)[[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SWI2]] | ||
|5112bp/1704aa, Chr. XV, viable | |5112bp/1704aa, Chr. XV, <br> viable | ||
|- | |- | ||
|SWI3 (aka TYE2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=swi3]] | |SWI3 (aka TYE2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=swi3]] | ||
|2478bp/826aa, Chr. X, viable | |2478bp/826aa, Chr. X,<br> viable | ||
|} | |} | ||
{| border="1" | {| border="1" | ||
Line 153: | Line 138: | ||
! size, chromosome, null p-type | ! size, chromosome, null p-type | ||
|- | |- | ||
|SNF5 | |SNF5 (aka HAF4, SWI10, TYE4)[[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SNF5]] | ||
| | |2718 bp/906aa, Chr. II <br>viable | ||
|- | |- | ||
|SNF6 | |SNF6 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SNF6]] | ||
| | |999bp/333aa, Chr. VIII, <br> viable | ||
|- | |- | ||
|SNF11 | |SNF11 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SNF11]] | ||
| | |510 bp/170aa, Chr. IV <br> viable | ||
|} | |} | ||
{| border="1" | {| border="1" | ||
Line 181: | Line 166: | ||
| | | | ||
|} | |} | ||
==Deletion Primers== | |||
* sgf73_URA3_KO_fwd (NO99) | |||
**5' TGAACACACAAGAGAAGCGCAAAAGAGTAAAGAGCTAAAatgtcgaaagctacatataa | |||
* sgf73_URA3_KO_rev (NO100) | |||
**5' CTCACTTCGTGAACATGCTGGATAACGTGCATGATTCAA ttagttttgctggccgcatc | |||
* sgf29_URA3_KO_fwd (NO101) | |||
**5' GACTTTTTCACAGCAAAACACACGGTCACCTTTCTTATTatgtcgaaagctacatataa | |||
* sgf29_URA3_KO_rev (NO102) | |||
**5' AGAAGATCTTATGATATGTAGTAAATGTTAACCACCATTttagttttgctggccgcatc |
Latest revision as of 15:17, 8 November 2006
in progress...
SAGA subunits, S. cerevisiae
most strains listed in Martens, Wu, Winston G&D paper 2005 [[1]]
link to FW yeast strain collection [[2]]
Parent strain for 109 deletion analysis: FY2068 = MAT(alpha) ura3-52 his3D200 leu2D1 lys2-128d
Ada subunits | size,chromosome,null p-type | deletion strain | genotype |
---|---|---|---|
Ada1 (aka HFI1, SUP110, SRM12, GAN1) [[3]] | 1.467 kb/489 aa, Chr. XVI, viable |
FY1560 aka NY383 |
MAT(A) ura3-52 his3D200 lys2-173R2 ada1::HIS3 |
Ada2 (aka SWI8) [[4]] | 1.305 kb/434aa, Chr. IV, viable |
FY1548 aka NY384 |
MAT(A) ura3-52 his3D200 leu2D1 lys2-128d ada2::HIS3 |
Ada3 (aka NGG1, SWI7) [[5]] | 2.109 kb/702aa, Chr. IV, viable |
FY1596 aka NY385 |
MAT(A) ura3-52 his3D200 his4-912d lys2-173R2 ada3::HIS3 |
Gcn5 (aka ADA4, SWI9) [[6]] | 1.32 kb/439aa, Chr. VII, viable |
FY1600 aka NY386 |
MAT(A) ura3-52 leu2D1 his3D200 his4-917d gcn5::HIS3 |
Ada5 (aka SPT20) [[7]] | 1.815 kb/604aa, Chr. XV, viable |
FY1098 | see spt20::URA3 |
Spt subunits | size, chromosome, null p-type | deletion strain | genotype |
---|---|---|---|
Spt3 [[8]] | 1.014 kb/337aa, Chr. IV, viable |
FY2142 aka NY387 |
MAT (alpha) spt3::KanMX |
Spt7 (aka GIT2) [[9]] | 3.999 kb/1332aa, Chr. II, viable |
FY963 aka NY388 |
MAT(A) ura3-52 his4-917d leu2d1 spt7::LEU2 |
Spt8 [[10]] | 1.809 kb/602aa, Chr. XII, viable |
FY50 aka NY389 |
MAT(A) ura3-52 his4-917d leu2d1 trp1d63 spt8d-302::LEU2 |
Spt20 (aka Ada5) [[11]] | 1.815 kb/604aa, Chr. XV, viable |
FY1098 aka NY390 |
MAT(A) ura3-52 his3d200 leu2d1 spt20d100::URA3 |
TAF subunits | size, chromosome, null p-type |
---|---|
TAF5 (aka TAF90) [[12]] | 2.397 kb/798aa, Chr. II, inviable |
TAF6 (aka TAF60) [[13]] | 1.551 kb/516aa, Chr. VII, inviable |
TAF9 (aka TAF17) [[14]] | 0.474 kb/157aa, Chr. XIII, inviable |
TAF10 (aka TAF23, TAF25) [[15]] | 0.621 kb/206aa, Chr. IV, inviable |
TAF12 (aka TAF61, TAF68) [[16]] | 1.620 kb/539aa, Chr. IV, inviable |
Tra1 subunit | size, chromosome, null p-type |
---|---|
Tra1 [[17]] | 11.235 kb/3744aa, Chr. VIII, inviable |
other subunits | size, chromosome, null p-type | deletion strain | genotype |
---|---|---|---|
Sgf73 [[18]] | 1.974 kb/657aa, Chr. VII , viable |
NY350 | MAT(A) ura3D0 his3D200 leu2D0 lys2-128d HAP1 DAN3:HIS3 sgf73::URA3 |
Sgf29 [[19]] | 0.779 kb/259aa, Chr. III, viable |
FY2474 | MAT(A) ura3-52 his4-917d leu2D1 lys2-173R2 arg4-12 sgf29D0::KanMX |
Sgf11 [[20]] | 0.3 kb/99aa, Chr.XVI, viable |
NY391 | MAT(A) ura3-52 his3D200 leu2D0 lys2-128d trp1-63 sgf11::KanMX |
Ubp8 [[21]] | 1.416 kb/471aa, Chr. XIII, viable |
FY2473 aka NY392 |
MAT(alpha) ura3-52 leu2D1 lys2-173R2 arg4-12 ubp8D0::KanMX |
Sus1 [[22]] | gene with intron, Chr. II, viable |
SWI/SNF subunits
SWI subunits | size,chromosome,null p-type |
---|---|
SWII (aka ADR6, GAM3, LPA1)[[23]] | 3945bp/1315 aa, Chr. XVI, inviable |
SWI2 (aka GAM1, HAF1, SNF2 , TYE3)[[24]] | 5112bp/1704aa, Chr. XV, viable |
SWI3 (aka TYE2) [[25]] | 2478bp/826aa, Chr. X, viable |
SNF subunits | size, chromosome, null p-type |
---|---|
SNF5 (aka HAF4, SWI10, TYE4)[[26]] | 2718 bp/906aa, Chr. II viable |
SNF6 [[27]] | 999bp/333aa, Chr. VIII, viable |
SNF11 [[28]] | 510 bp/170aa, Chr. IV viable |
SWP subunits | size, chromosome, null p-type |
---|---|
SWP82 | |
SWP73 | |
SWP59 | |
SWP61 | |
SWP29 |
Deletion Primers
- sgf73_URA3_KO_fwd (NO99)
- 5' TGAACACACAAGAGAAGCGCAAAAGAGTAAAGAGCTAAAatgtcgaaagctacatataa
- sgf73_URA3_KO_rev (NO100)
- 5' CTCACTTCGTGAACATGCTGGATAACGTGCATGATTCAA ttagttttgctggccgcatc
- sgf29_URA3_KO_fwd (NO101)
- 5' GACTTTTTCACAGCAAAACACACGGTCACCTTTCTTATTatgtcgaaagctacatataa
- sgf29_URA3_KO_rev (NO102)
- 5' AGAAGATCTTATGATATGTAGTAAATGTTAACCACCATTttagttttgctggccgcatc