User:Nkuldell/SAGA vs Swi/Snf

From OpenWetWare

< User:Nkuldell(Difference between revisions)
Jump to: navigation, search
Current revision (18:17, 8 November 2006) (view source)
 
Line 166: Line 166:
|
|
|}
|}
 +
 +
 +
==Deletion Primers==
 +
* sgf73_URA3_KO_fwd (NO99)
 +
**5' TGAACACACAAGAGAAGCGCAAAAGAGTAAAGAGCTAAAatgtcgaaagctacatataa
 +
* sgf73_URA3_KO_rev (NO100)
 +
**5' CTCACTTCGTGAACATGCTGGATAACGTGCATGATTCAA ttagttttgctggccgcatc
 +
* sgf29_URA3_KO_fwd (NO101)
 +
**5' GACTTTTTCACAGCAAAACACACGGTCACCTTTCTTATTatgtcgaaagctacatataa
 +
* sgf29_URA3_KO_rev (NO102)
 +
**5' AGAAGATCTTATGATATGTAGTAAATGTTAACCACCATTttagttttgctggccgcatc

Current revision

in progress...

SAGA subunits, S. cerevisiae

most strains listed in Martens, Wu, Winston G&D paper 2005 [[1]]
link to FW yeast strain collection [[2]]
Parent strain for 109 deletion analysis: FY2068 = MAT(alpha) ura3-52 his3D200 leu2D1 lys2-128d

Ada subunits size,chromosome,null p-type deletion strain genotype
Ada1 (aka HFI1, SUP110, SRM12, GAN1) [[3]] 1.467 kb/489 aa, Chr. XVI,
viable
FY1560
aka NY383
MAT(A) ura3-52 his3D200 lys2-173R2
ada1::HIS3
Ada2 (aka SWI8) [[4]] 1.305 kb/434aa, Chr. IV,
viable
FY1548
aka NY384
MAT(A) ura3-52 his3D200 leu2D1 lys2-128d
ada2::HIS3
Ada3 (aka NGG1, SWI7) [[5]] 2.109 kb/702aa, Chr. IV,
viable
FY1596
aka NY385
MAT(A) ura3-52 his3D200 his4-912d lys2-173R2
ada3::HIS3
Gcn5 (aka ADA4, SWI9) [[6]] 1.32 kb/439aa, Chr. VII,
viable
FY1600
aka NY386
MAT(A) ura3-52 leu2D1 his3D200 his4-917d
gcn5::HIS3
Ada5 (aka SPT20) [[7]] 1.815 kb/604aa, Chr. XV,
viable
FY1098 see spt20::URA3
Spt subunits size, chromosome, null p-type deletion strain genotype
Spt3 [[8]] 1.014 kb/337aa, Chr. IV,
viable
FY2142
aka NY387
MAT (alpha)
spt3::KanMX
Spt7 (aka GIT2) [[9]] 3.999 kb/1332aa, Chr. II,
viable
FY963
aka NY388
MAT(A) ura3-52 his4-917d leu2d1
spt7::LEU2
Spt8 [[10]] 1.809 kb/602aa, Chr. XII,
viable
FY50
aka NY389
MAT(A) ura3-52 his4-917d leu2d1 trp1d63
spt8d-302::LEU2
Spt20 (aka Ada5) [[11]] 1.815 kb/604aa, Chr. XV,
viable
FY1098
aka NY390
MAT(A) ura3-52 his3d200 leu2d1
spt20d100::URA3
TAF subunits size, chromosome, null p-type
TAF5 (aka TAF90) [[12]] 2.397 kb/798aa, Chr. II, inviable
TAF6 (aka TAF60) [[13]] 1.551 kb/516aa, Chr. VII, inviable
TAF9 (aka TAF17) [[14]] 0.474 kb/157aa, Chr. XIII, inviable
TAF10 (aka TAF23, TAF25) [[15]] 0.621 kb/206aa, Chr. IV, inviable
TAF12 (aka TAF61, TAF68) [[16]] 1.620 kb/539aa, Chr. IV, inviable
Tra1 subunit size, chromosome, null p-type
Tra1 [[17]] 11.235 kb/3744aa, Chr. VIII, inviable
other subunits size, chromosome, null p-type deletion strain genotype
Sgf73 [[18]] 1.974 kb/657aa, Chr. VII ,
viable
NY350 MAT(A) ura3D0 his3D200 leu2D0 lys2-128d HAP1 DAN3:HIS3
sgf73::URA3
Sgf29 [[19]] 0.779 kb/259aa, Chr. III,
viable
FY2474 MAT(A) ura3-52 his4-917d leu2D1 lys2-173R2 arg4-12
sgf29D0::KanMX
Sgf11 [[20]] 0.3 kb/99aa, Chr.XVI,
viable
NY391 MAT(A) ura3-52 his3D200 leu2D0 lys2-128d trp1-63
sgf11::KanMX
Ubp8 [[21]] 1.416 kb/471aa, Chr. XIII,
viable
FY2473
aka NY392
MAT(alpha) ura3-52 leu2D1 lys2-173R2 arg4-12
ubp8D0::KanMX
Sus1 [[22]] gene with intron, Chr. II,
viable

SWI/SNF subunits

SWI subunits size,chromosome,null p-type
SWII (aka ADR6, GAM3, LPA1)[[23]] 3945bp/1315 aa, Chr. XVI,
inviable
SWI2 (aka GAM1, HAF1, SNF2 , TYE3)[[24]] 5112bp/1704aa, Chr. XV,
viable
SWI3 (aka TYE2) [[25]] 2478bp/826aa, Chr. X,
viable
SNF subunits size, chromosome, null p-type
SNF5 (aka HAF4, SWI10, TYE4)[[26]] 2718 bp/906aa, Chr. II
viable
SNF6 [[27]] 999bp/333aa, Chr. VIII,
viable
SNF11 [[28]] 510 bp/170aa, Chr. IV
viable
SWP subunits size, chromosome, null p-type
SWP82
SWP73
SWP59
SWP61
SWP29


Deletion Primers

  • sgf73_URA3_KO_fwd (NO99)
    • 5' TGAACACACAAGAGAAGCGCAAAAGAGTAAAGAGCTAAAatgtcgaaagctacatataa
  • sgf73_URA3_KO_rev (NO100)
    • 5' CTCACTTCGTGAACATGCTGGATAACGTGCATGATTCAA ttagttttgctggccgcatc
  • sgf29_URA3_KO_fwd (NO101)
    • 5' GACTTTTTCACAGCAAAACACACGGTCACCTTTCTTATTatgtcgaaagctacatataa
  • sgf29_URA3_KO_rev (NO102)
    • 5' AGAAGATCTTATGATATGTAGTAAATGTTAACCACCATTttagttttgctggccgcatc
Personal tools