User:Nkuldell/SAGA vs Swi/Snf - Revision history

Nkuldell at 22:17, 8 November 2006

Nkuldell — Wed, 08 Nov 2006 22:17:11 GMT

←Older revision		Revision as of 22:17, 8 November 2006
Line 166:		Line 166:
	\|		\|
	\|}		\|}
		+
		+
		+	==Deletion Primers==
		+	* sgf73_URA3_KO_fwd (NO99)
		+	**5' TGAACACACAAGAGAAGCGCAAAAGAGTAAAGAGCTAAAatgtcgaaagctacatataa
		+	* sgf73_URA3_KO_rev (NO100)
		+	**5' CTCACTTCGTGAACATGCTGGATAACGTGCATGATTCAA ttagttttgctggccgcatc
		+	* sgf29_URA3_KO_fwd (NO101)
		+	**5' GACTTTTTCACAGCAAAACACACGGTCACCTTTCTTATTatgtcgaaagctacatataa
		+	* sgf29_URA3_KO_rev (NO102)
		+	**5' AGAAGATCTTATGATATGTAGTAAATGTTAACCACCATTttagttttgctggccgcatc

Nkuldell at 22:15, 8 November 2006

Nkuldell — Wed, 08 Nov 2006 22:15:14 GMT

Nkuldell: /* SWI/SNF subunits */

Nkuldell — Wed, 01 Nov 2006 11:14:52 GMT

SWI/SNF subunits

←Older revision		Revision as of 11:14, 1 November 2006
Line 138:		Line 138:
	! size, chromosome, null p-type		! size, chromosome, null p-type
	\|-		\|-
-	\|SNF5	+	\|SNF5 (aka HAF4, SWI10, TYE4)[[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SNF5]]
-	\|	+	\|2718 bp/906aa, Chr. II <br>viable
	\|-		\|-
-	\|SNF6	+	\|SNF6 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SNF6]]
-	\|	+	\|999bp/333aa, Chr. VIII, <br> viable
	\|-		\|-
-	\|SNF11	+	\|SNF11 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SNF11]]
-	\|	+	\|510 bp/170aa, Chr. IV <br> viable
	\|}		\|}
	{\| border="1"		{\| border="1"

Nkuldell at 03:42, 1 November 2006

Nkuldell — Wed, 01 Nov 2006 03:42:13 GMT

←Older revision		Revision as of 03:42, 1 November 2006
Line 50:		Line 50:
	\| 3.999 kb/1332aa, Chr. II, <br> viable		\| 3.999 kb/1332aa, Chr. II, <br> viable
	\| FY963		\| FY963
-	\| MAT(A) ura3-52 ~~leu2d1~~ his4-917d <br> <b> spt7::LEU2 </b>	+	\| MAT(A) ura3-52 his4-917d leu2d1 <br> <b> spt7::LEU2 </b>
	\|-		\|-
	\| Spt8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt8]]		\| Spt8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt8]]
	\| 1.809 kb/602aa, Chr. XII, <br> viable		\| 1.809 kb/602aa, Chr. XII, <br> viable
	\| FY50		\| FY50
-	\| MAT(A) ura3-52 ~~leu2d1~~ his4-917d trp1d63 <br> <b>spt8d-302::LEU2 </b>	+	\| MAT(A) ura3-52 his4-917d leu2d1 trp1d63 <br> <b>spt8d-302::LEU2 </b>
	\|-		\|-
	\| Spt20 (aka Ada5) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SPT20]]		\| Spt20 (aka Ada5) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SPT20]]
	\| 1.815 kb/604aa, Chr. XV, <br> viable		\| 1.815 kb/604aa, Chr. XV, <br> viable
	\| FY1098		\| FY1098
-	\| MAT(A) ura3-52 ~~leu2d1~~ his3d200 <br> <b>spt20d100::URA3 </b>	+	\| MAT(A) ura3-52 his3d200 leu2d1 <br> <b>spt20d100::URA3 </b>
	\|}		\|}
	{\| border="1"		{\| border="1"
-	! TAF subunits~~, cerevisiae </i>~~	+	! TAF subunits
	! size, chromosome, null p-type		! size, chromosome, null p-type
	\|-		\|-
Line 95:		Line 95:
	\|-		\|-
	\| Sgf73 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf73]]		\| Sgf73 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf73]]
-	\| 1.974 kb/657aa, Chr. VII , viable	+	\| 1.974 kb/657aa, Chr. VII , <br> viable
	\|		\|
	\|		\|
	\|-		\|-
	\| Sgf29 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf29]]		\| Sgf29 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf29]]
-	\| 0.779 kb/259aa, Chr. III, viable	+	\| 0.779 kb/259aa, Chr. III, <br> viable
-	\|	+	\| FY2474
-	\|	+	\| MAT(A) ura3-52 his4-917d leu2D1 lys2-173R2 arg4-12 <br> <b> sgf29D0::KanMX </b>
	\|-		\|-
	\| Sgf11 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf11]]		\| Sgf11 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf11]]
-	\| 0.3 kb/99aa, Chr.XVI, viable	+	\| 0.3 kb/99aa, Chr.XVI, <br> viable
	\|		\|
	\|		\|
	\|-		\|-
	\| Ubp8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ubp8]]		\| Ubp8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ubp8]]
-	\| 1.416 kb/471aa, Chr. XIII, viable	+	\| 1.416 kb/471aa, Chr. XIII, <br> viable
-	\|	+	\| FY2473
-	\|	+	\| MAT(alpha) ura3-52 leu2D1 lys2-173R2 arg4-12 <br> <b>ubp8D0::KanMX </b>
	\|-		\|-
	\| Sus1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Sus1]]		\| Sus1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Sus1]]
-	\| gene with intron, Chr. II, viable	+	\| gene with intron, Chr. II, <br> viable
	\|		\|
	\|		\|
Line 126:		Line 126:
	\|-		\|-
	\|SWII (aka ADR6, GAM3, LPA1)[[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=swi1]]		\|SWII (aka ADR6, GAM3, LPA1)[[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=swi1]]
-	\|3945bp/1315 aa, Chr. XVI, <font color =red> inviable </font color>	+	\|3945bp/1315 aa, Chr. XVI, <br> <font color =red> inviable </font color>
	\|-		\|-
	\|SWI2 (aka GAM1, HAF1, <font color = red> SNF2 </font color>, TYE3)[[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SWI2]]		\|SWI2 (aka GAM1, HAF1, <font color = red> SNF2 </font color>, TYE3)[[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SWI2]]
-	\|5112bp/1704aa, Chr. XV, viable	+	\|5112bp/1704aa, Chr. XV, <br> viable
	\|-		\|-
	\|SWI3 (aka TYE2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=swi3]]		\|SWI3 (aka TYE2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=swi3]]
-	\|2478bp/826aa, Chr. X, viable	+	\|2478bp/826aa, Chr. X,<br> viable
	\|}		\|}
	{\| border="1"		{\| border="1"

Nkuldell at 03:30, 1 November 2006

Nkuldell — Wed, 01 Nov 2006 03:30:40 GMT

←Older revision		Revision as of 03:30, 1 November 2006
Line 14:		Line 14:
	\| 1.467 kb/489 aa, Chr. XVI, <br>viable		\| 1.467 kb/489 aa, Chr. XVI, <br>viable
	\| FY1560		\| FY1560
-	\| MAT(A) ura3-52, his3D200, lys2-173R2, <br> <b>ada1::HIS3</b>	+	\| MAT(A) ura3-52 his3D200 lys2-173R2 <br> <b>ada1::HIS3</b>
	\|-		\|-
	\| Ada2 (aka SWI8) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA2]]		\| Ada2 (aka SWI8) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA2]]
	\| 1.305 kb/434aa, Chr. IV, <br>viable		\| 1.305 kb/434aa, Chr. IV, <br>viable
	\| FY1548		\| FY1548
-	\| MAT(A) ura3-52, his3D200, leu2D1, lys2-128d, <br> <b> ada2::HIS3 </b>	+	\| MAT(A) ura3-52 his3D200 leu2D1 lys2-128d <br> <b> ada2::HIS3 </b>
	\|-		\|-
	\| Ada3 (aka NGG1, SWI7) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA3]]		\| Ada3 (aka NGG1, SWI7) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA3]]
	\| 2.109 kb/702aa, Chr. IV, <br>viable		\| 2.109 kb/702aa, Chr. IV, <br>viable
	\| FY1596		\| FY1596
-	\| MAT(A) ura3-52, his3D200, his4-912d, lys2-173R2, <br> <b> ada3::HIS3 </b>	+	\| MAT(A) ura3-52 his3D200 his4-912d lys2-173R2 <br> <b> ada3::HIS3 </b>
	\|-		\|-
	\| Gcn5 (aka ADA4, SWI9) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=GCN5]]		\| Gcn5 (aka ADA4, SWI9) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=GCN5]]
	\| 1.32 kb/439aa, Chr. VII, <br>viable		\| 1.32 kb/439aa, Chr. VII, <br>viable
	\| FY1600		\| FY1600
-	\| MAT(A) ura3-52, leu2D1, his3D200, his4-917d, <br> <b> gcn5::HIS3 </b>	+	\| MAT(A) ura3-52 leu2D1 his3D200 his4-917d <br> <b> gcn5::HIS3 </b>
	\|-		\|-
	\| Ada5 (aka SPT20) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Ada5]]		\| Ada5 (aka SPT20) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Ada5]]
	\| 1.815 kb/604aa, Chr. XV, <br>viable		\| 1.815 kb/604aa, Chr. XV, <br>viable
-	\|	+	\| FY1098
-	\|	+	\| see spt20::URA3
	\|}		\|}
	{\| border="1"		{\| border="1"
Line 43:		Line 43:
	\|-		\|-
	\| Spt3 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=spt3]]		\| Spt3 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=spt3]]
-	\| 1.014 kb/337aa, ~~<br>~~ Chr. IV, viable	+	\| 1.014 kb/337aa, Chr. IV, <br> viable
-	\|	+	\| FY2142
-	\|	+	\| MAT (alpha) <br> <b> spt3::KanMX </b>
	\|-		\|-
	\| Spt7 (aka GIT2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt7]]		\| Spt7 (aka GIT2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt7]]
-	\| 3.999 kb/1332aa, ~~<br>~~ Chr. II, viable	+	\| 3.999 kb/1332aa, Chr. II, <br> viable
-	\|	+	\| FY963
-	\|	+	\| MAT(A) ura3-52 leu2d1 his4-917d <br> <b> spt7::LEU2 </b>
	\|-		\|-
	\| Spt8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt8]]		\| Spt8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt8]]
-	\| 1.809 kb/602aa, ~~<br>~~ Chr. XII, viable	+	\| 1.809 kb/602aa, Chr. XII, <br> viable
-	\|	+	\| FY50
-	\|	+	\| MAT(A) ura3-52 leu2d1 his4-917d trp1d63 <br> <b>spt8d-302::LEU2 </b>
	\|-		\|-
	\| Spt20 (aka Ada5) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SPT20]]		\| Spt20 (aka Ada5) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SPT20]]
-	\| ~~same as Ada5 <br>~~ 1.815 kb/604aa, Chr. XV, viable	+	\| 1.815 kb/604aa, Chr. XV, <br> viable
-	\|	+	\| FY1098
-	\|	+	\| MAT(A) ura3-52 leu2d1 his3d200 <br> <b>spt20d100::URA3 </b>
	\|}		\|}
	{\| border="1"		{\| border="1"

Nkuldell at 03:21, 1 November 2006

Nkuldell — Wed, 01 Nov 2006 03:21:12 GMT

←Older revision		Revision as of 03:21, 1 November 2006
Line 4:		Line 4:
	most strains listed in Martens, Wu, Winston G&D paper 2005 [[http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Retrieve&dopt=AbstractPlus&list_uids=16291644&query_hl=10&itool=pubmed_docsum]]		most strains listed in Martens, Wu, Winston G&D paper 2005 [[http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Retrieve&dopt=AbstractPlus&list_uids=16291644&query_hl=10&itool=pubmed_docsum]]
	<br>link to FW yeast strain collection [[http://genepath.med.harvard.edu/strainfinder/yeast.php]] <br>		<br>link to FW yeast strain collection [[http://genepath.med.harvard.edu/strainfinder/yeast.php]] <br>
-	Parent strain for 109 deletion analysis:	+	Parent strain for 109 deletion analysis: FY2068 = MAT(alpha) ura3-52 his3D200 leu2D1 lys2-128d
	{\| border="1"		{\| border="1"
	! Ada subunits		! Ada subunits
Line 12:		Line 12:
	\|-		\|-
	\| Ada1 (aka HFI1, SUP110, SRM12, GAN1) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA1]]		\| Ada1 (aka HFI1, SUP110, SRM12, GAN1) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA1]]
-	\| 1.467 kb/489 aa, ~~<br>~~ Chr. XVI, viable	+	\| 1.467 kb/489 aa, Chr. XVI, <br>viable
-	\|	+	\| FY1560
-	\|	+	\| MAT(A) ura3-52, his3D200, lys2-173R2, <br> <b>ada1::HIS3</b>
	\|-		\|-
	\| Ada2 (aka SWI8) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA2]]		\| Ada2 (aka SWI8) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA2]]
-	\| 1.305 kb/434aa, ~~<br>~~ Chr. IV, viable	+	\| 1.305 kb/434aa, Chr. IV, <br>viable
-	\|	+	\| FY1548
-	\|	+	\| MAT(A) ura3-52, his3D200, leu2D1, lys2-128d, <br> <b> ada2::HIS3 </b>
	\|-		\|-
	\| Ada3 (aka NGG1, SWI7) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA3]]		\| Ada3 (aka NGG1, SWI7) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA3]]
-	\| 2.109 kb/702aa, ~~<br>~~ Chr. IV, viable	+	\| 2.109 kb/702aa, Chr. IV, <br>viable
-	\|	+	\| FY1596
-	\|	+	\| MAT(A) ura3-52, his3D200, his4-912d, lys2-173R2, <br> <b> ada3::HIS3 </b>
	\|-		\|-
	\| Gcn5 (aka ADA4, SWI9) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=GCN5]]		\| Gcn5 (aka ADA4, SWI9) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=GCN5]]
-	\| 1.32 kb/439aa, ~~<br>~~ Chr. VII, viable	+	\| 1.32 kb/439aa, Chr. VII, <br>viable
-	\|	+	\| FY1600
-	\|	+	\| MAT(A) ura3-52, leu2D1, his3D200, his4-917d, <br> <b> gcn5::HIS3 </b>
	\|-		\|-
	\| Ada5 (aka SPT20) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Ada5]]		\| Ada5 (aka SPT20) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Ada5]]
-	\| 1.815 kb/604aa, ~~<br>~~ Chr. XV, viable	+	\| 1.815 kb/604aa, Chr. XV, <br>viable
	\|		\|
	\|		\|

Nkuldell at 12:31, 31 October 2006

Nkuldell — Tue, 31 Oct 2006 12:31:09 GMT

Nkuldell at 12:29, 31 October 2006

Nkuldell — Tue, 31 Oct 2006 12:29:44 GMT

←Older revision		Revision as of 12:29, 31 October 2006
Line 2:		Line 2:

	==SAGA subunits, <i> S. cerevisiae </i>==		==SAGA subunits, <i> S. cerevisiae </i>==
-	link to FW yeast strain collection [[http://genepath.med.harvard.edu/strainfinder/yeast.php]] <br>	+	most strains listed in Martens, Wu, Winston G&D paper 2005 [[http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Retrieve&dopt=AbstractPlus&list_uids=16291644&query_hl=10&itool=pubmed_docsum]]
		+	<br>link to FW yeast strain collection [[http://genepath.med.harvard.edu/strainfinder/yeast.php]] <br>
	Parent strain for 109 deletion analysis:		Parent strain for 109 deletion analysis:
	{\| border="1"		{\| border="1"

Nkuldell at 12:16, 31 October 2006

Nkuldell — Tue, 31 Oct 2006 12:16:13 GMT

Nkuldell: /* SWI/SNF subunits */

Nkuldell — Mon, 30 Oct 2006 02:30:59 GMT

SWI/SNF subunits

←Older revision		Revision as of 02:30, 30 October 2006
Line 94:		Line 94:
	\|5112bp/1704aa, Chr. XV, viable		\|5112bp/1704aa, Chr. XV, viable
	\|-		\|-
-	\|SWI3	+	\|SWI3 (aka TYE2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=swi3]]
-	\|	+	\|2478bp/826aa, Chr. X, viable
	\|}		\|}
	{\| border="1"		{\| border="1"

←Older revision		Revision as of 22:15, 8 November 2006
Line 13:		Line 13:
	\| Ada1 (aka HFI1, SUP110, SRM12, GAN1) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA1]]		\| Ada1 (aka HFI1, SUP110, SRM12, GAN1) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA1]]
	\| 1.467 kb/489 aa, Chr. XVI, <br>viable		\| 1.467 kb/489 aa, Chr. XVI, <br>viable
-	\| FY1560	+	\| FY1560<br> aka NY383
	\| MAT(A) ura3-52 his3D200 lys2-173R2 <br> <b>ada1::HIS3</b>		\| MAT(A) ura3-52 his3D200 lys2-173R2 <br> <b>ada1::HIS3</b>
	\|-		\|-
	\| Ada2 (aka SWI8) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA2]]		\| Ada2 (aka SWI8) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA2]]
	\| 1.305 kb/434aa, Chr. IV, <br>viable		\| 1.305 kb/434aa, Chr. IV, <br>viable
-	\| FY1548	+	\| FY1548<br> aka NY384
	\| MAT(A) ura3-52 his3D200 leu2D1 lys2-128d <br> <b> ada2::HIS3 </b>		\| MAT(A) ura3-52 his3D200 leu2D1 lys2-128d <br> <b> ada2::HIS3 </b>
	\|-		\|-
	\| Ada3 (aka NGG1, SWI7) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA3]]		\| Ada3 (aka NGG1, SWI7) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA3]]
	\| 2.109 kb/702aa, Chr. IV, <br>viable		\| 2.109 kb/702aa, Chr. IV, <br>viable
-	\| FY1596	+	\| FY1596<br> aka NY385
	\| MAT(A) ura3-52 his3D200 his4-912d lys2-173R2 <br> <b> ada3::HIS3 </b>		\| MAT(A) ura3-52 his3D200 his4-912d lys2-173R2 <br> <b> ada3::HIS3 </b>
	\|-		\|-
	\| Gcn5 (aka ADA4, SWI9) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=GCN5]]		\| Gcn5 (aka ADA4, SWI9) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=GCN5]]
	\| 1.32 kb/439aa, Chr. VII, <br>viable		\| 1.32 kb/439aa, Chr. VII, <br>viable
-	\| FY1600	+	\| FY1600<br> aka NY386
	\| MAT(A) ura3-52 leu2D1 his3D200 his4-917d <br> <b> gcn5::HIS3 </b>		\| MAT(A) ura3-52 leu2D1 his3D200 his4-917d <br> <b> gcn5::HIS3 </b>
	\|-		\|-
Line 44:		Line 44:
	\| Spt3 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=spt3]]		\| Spt3 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=spt3]]
	\| 1.014 kb/337aa, Chr. IV, <br> viable		\| 1.014 kb/337aa, Chr. IV, <br> viable
-	\| FY2142	+	\| FY2142<br> aka NY387
	\| MAT (alpha) <br> <b> spt3::KanMX </b>		\| MAT (alpha) <br> <b> spt3::KanMX </b>
	\|-		\|-
	\| Spt7 (aka GIT2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt7]]		\| Spt7 (aka GIT2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt7]]
	\| 3.999 kb/1332aa, Chr. II, <br> viable		\| 3.999 kb/1332aa, Chr. II, <br> viable
-	\| FY963	+	\| FY963<br> aka NY388
	\| MAT(A) ura3-52 his4-917d leu2d1 <br> <b> spt7::LEU2 </b>		\| MAT(A) ura3-52 his4-917d leu2d1 <br> <b> spt7::LEU2 </b>
	\|-		\|-
	\| Spt8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt8]]		\| Spt8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt8]]
	\| 1.809 kb/602aa, Chr. XII, <br> viable		\| 1.809 kb/602aa, Chr. XII, <br> viable
-	\| FY50	+	\| FY50<br> aka NY389
	\| MAT(A) ura3-52 his4-917d leu2d1 trp1d63 <br> <b>spt8d-302::LEU2 </b>		\| MAT(A) ura3-52 his4-917d leu2d1 trp1d63 <br> <b>spt8d-302::LEU2 </b>
	\|-		\|-
	\| Spt20 (aka Ada5) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SPT20]]		\| Spt20 (aka Ada5) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SPT20]]
	\| 1.815 kb/604aa, Chr. XV, <br> viable		\| 1.815 kb/604aa, Chr. XV, <br> viable
-	\| FY1098	+	\| FY1098<br> aka NY390
	\| MAT(A) ura3-52 his3d200 leu2d1 <br> <b>spt20d100::URA3 </b>		\| MAT(A) ura3-52 his3d200 leu2d1 <br> <b>spt20d100::URA3 </b>
	\|}		\|}
Line 96:		Line 96:
	\| Sgf73 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf73]]		\| Sgf73 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf73]]
	\| 1.974 kb/657aa, Chr. VII , <br> viable		\| 1.974 kb/657aa, Chr. VII , <br> viable
-	\|	+	\| NY350
-	\|	+	\| MAT(A) ura3D0 his3D200 leu2D0 lys2-128d HAP1 DAN3:HIS3 <br> <b> sgf73::URA3</b>
	\|-		\|-
	\| Sgf29 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf29]]		\| Sgf29 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf29]]
Line 106:		Line 106:
	\| Sgf11 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf11]]		\| Sgf11 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf11]]
	\| 0.3 kb/99aa, Chr.XVI, <br> viable		\| 0.3 kb/99aa, Chr.XVI, <br> viable
-	\|	+	\| NY391
-	\|	+	\| MAT(A) ura3-52 his3D200 leu2D0 lys2-128d trp1-63 <br> <b> sgf11::KanMX </b>
	\|-		\|-
	\| Ubp8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ubp8]]		\| Ubp8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ubp8]]
	\| 1.416 kb/471aa, Chr. XIII, <br> viable		\| 1.416 kb/471aa, Chr. XIII, <br> viable
-	\| FY2473	+	\| FY2473 <br> aka NY392
	\| MAT(alpha) ura3-52 leu2D1 lys2-173R2 arg4-12 <br> <b>ubp8D0::KanMX </b>		\| MAT(alpha) ura3-52 leu2D1 lys2-173R2 arg4-12 <br> <b>ubp8D0::KanMX </b>
	\|-		\|-

←Older revision		Revision as of 12:31, 31 October 2006
Line 65:		Line 65:
	! TAF subunits, cerevisiae </i>		! TAF subunits, cerevisiae </i>
	! size, chromosome, null p-type		! size, chromosome, null p-type
-	~~! deletion strain~~
-	~~! genotype~~
	\|-		\|-
	\| TAF5 (aka TAF90) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF5]]		\| TAF5 (aka TAF90) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF5]]
	\| 2.397 kb/798aa, Chr. II, <font color = red>inviable</font color>		\| 2.397 kb/798aa, Chr. II, <font color = red>inviable</font color>
-	\|
-	\|
	\|-		\|-
	\| TAF6 (aka TAF60) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF6]]		\| TAF6 (aka TAF60) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF6]]
-	\| 1.551 kb/516aa, Chr. VII, <font color = red>inviable</font color>	+	\| 1.551 kb/516aa, Chr. VII, <font color = red>inviable</font color>
-	\|	+
-	\|	+
	\|-		\|-
	\| TAF9 (aka TAF17) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF9]]		\| TAF9 (aka TAF17) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF9]]
	\| 0.474 kb/157aa, Chr. XIII, <font color = red>inviable</font color>		\| 0.474 kb/157aa, Chr. XIII, <font color = red>inviable</font color>
-	\|
-	\|
	\|-		\|-
	\| TAF10 (aka TAF23, TAF25) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF10]]		\| TAF10 (aka TAF23, TAF25) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF10]]
	\| 0.621 kb/206aa, Chr. IV, <font color = red>inviable</font color>		\| 0.621 kb/206aa, Chr. IV, <font color = red>inviable</font color>
-	\|
-	\|
	\|-		\|-
	\| TAF12 (aka TAF61, TAF68) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF12]]		\| TAF12 (aka TAF61, TAF68) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF12]]
-	\| 1.620 kb/539aa, Chr. IV, <font color = red>inviable</font color>	+	\| 1.620 kb/539aa, Chr. IV, <font color = red>inviable</font color>
-	\|	+
-	\|	+
	\|}		\|}
	{\| border="1"		{\| border="1"
	! Tra1 subunit		! Tra1 subunit
-	! size, chromosome, null p-type	+	! size, chromosome, null p-type
-	~~! deletion strain~~	+
-	~~! genotype~~	+
	\|-		\|-
	\| Tra1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TRA1]]		\| Tra1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TRA1]]
	\| 11.235 kb/3744aa, Chr. VIII, <font color = red>inviable</font color>		\| 11.235 kb/3744aa, Chr. VIII, <font color = red>inviable</font color>
-	\|
-	\|
	\|}		\|}
	{\| border="1"		{\| border="1"

←Older revision		Revision as of 12:16, 31 October 2006
Line 2:		Line 2:

	==SAGA subunits, <i> S. cerevisiae </i>==		==SAGA subunits, <i> S. cerevisiae </i>==
		+	link to FW yeast strain collection [[http://genepath.med.harvard.edu/strainfinder/yeast.php]] <br>
		+	Parent strain for 109 deletion analysis:
	{\| border="1"		{\| border="1"
	! Ada subunits		! Ada subunits
-	! size,chromosome,null p-type	+	! size,chromosome,null p-type
		+	! deletion strain
		+	! genotype
	\|-		\|-
	\| Ada1 (aka HFI1, SUP110, SRM12, GAN1) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA1]]		\| Ada1 (aka HFI1, SUP110, SRM12, GAN1) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA1]]
-	\| 1.467 kb/489 aa, <br> Chr. XVI, viable	+	\| 1.467 kb/489 aa, <br> Chr. XVI, viable
		+	\|
		+	\|
	\|-		\|-
	\| Ada2 (aka SWI8) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA2]]		\| Ada2 (aka SWI8) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA2]]
-	\| 1.305 kb/434aa, <br> Chr. IV, viable	+	\| 1.305 kb/434aa, <br> Chr. IV, viable
		+	\|
		+	\|
	\|-		\|-
	\| Ada3 (aka NGG1, SWI7) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA3]]		\| Ada3 (aka NGG1, SWI7) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ADA3]]
	\| 2.109 kb/702aa, <br> Chr. IV, viable		\| 2.109 kb/702aa, <br> Chr. IV, viable
		+	\|
		+	\|
	\|-		\|-
	\| Gcn5 (aka ADA4, SWI9) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=GCN5]]		\| Gcn5 (aka ADA4, SWI9) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=GCN5]]
-	\| 1.32 kb/439aa, <br> Chr. VII, viable	+	\| 1.32 kb/439aa, <br> Chr. VII, viable
		+	\|
		+	\|
	\|-		\|-
	\| Ada5 (aka SPT20) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Ada5]]		\| Ada5 (aka SPT20) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Ada5]]
	\| 1.815 kb/604aa, <br> Chr. XV, viable		\| 1.815 kb/604aa, <br> Chr. XV, viable
		+	\|
		+	\|
	\|}		\|}
	{\| border="1"		{\| border="1"
	! Spt subunits		! Spt subunits
-	! size, chromosome, null p-type	+	! size, chromosome, null p-type
		+	! deletion strain
		+	! genotype
	\|-		\|-
	\| Spt3 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=spt3]]		\| Spt3 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=spt3]]
	\| 1.014 kb/337aa, <br> Chr. IV, viable		\| 1.014 kb/337aa, <br> Chr. IV, viable
		+	\|
		+	\|
	\|-		\|-
	\| Spt7 (aka GIT2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt7]]		\| Spt7 (aka GIT2) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt7]]
-	\| 3.999 kb/1332aa, <br> Chr. II, viable	+	\| 3.999 kb/1332aa, <br> Chr. II, viable
		+	\|
		+	\|
	\|-		\|-
	\| Spt8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt8]]		\| Spt8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Spt8]]
	\| 1.809 kb/602aa, <br> Chr. XII, viable		\| 1.809 kb/602aa, <br> Chr. XII, viable
		+	\|
		+	\|
	\|-		\|-
	\| Spt20 (aka Ada5) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SPT20]]		\| Spt20 (aka Ada5) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=SPT20]]
-	\| same as Ada5 <br> 1.815 kb/604aa, Chr. XV, viable	+	\| same as Ada5 <br> 1.815 kb/604aa, Chr. XV, viable
		+	\|
		+	\|
	\|}		\|}
	{\| border="1"		{\| border="1"
	! TAF subunits, cerevisiae </i>		! TAF subunits, cerevisiae </i>
-	! size, chromosome, null p-type	+	! size, chromosome, null p-type
		+	! deletion strain
		+	! genotype
	\|-		\|-
	\| TAF5 (aka TAF90) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF5]]		\| TAF5 (aka TAF90) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF5]]
	\| 2.397 kb/798aa, Chr. II, <font color = red>inviable</font color>		\| 2.397 kb/798aa, Chr. II, <font color = red>inviable</font color>
		+	\|
		+	\|
	\|-		\|-
	\| TAF6 (aka TAF60) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF6]]		\| TAF6 (aka TAF60) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF6]]
-	\| 1.551 kb/516aa, Chr. VII, <font color = red>inviable</font color>	+	\| 1.551 kb/516aa, Chr. VII, <font color = red>inviable</font color>
		+	\|
		+	\|
	\|-		\|-
	\| TAF9 (aka TAF17) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF9]]		\| TAF9 (aka TAF17) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF9]]
	\| 0.474 kb/157aa, Chr. XIII, <font color = red>inviable</font color>		\| 0.474 kb/157aa, Chr. XIII, <font color = red>inviable</font color>
		+	\|
		+	\|
	\|-		\|-
	\| TAF10 (aka TAF23, TAF25) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF10]]		\| TAF10 (aka TAF23, TAF25) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF10]]
	\| 0.621 kb/206aa, Chr. IV, <font color = red>inviable</font color>		\| 0.621 kb/206aa, Chr. IV, <font color = red>inviable</font color>
		+	\|
		+	\|
	\|-		\|-
	\| TAF12 (aka TAF61, TAF68) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF12]]		\| TAF12 (aka TAF61, TAF68) [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TAF12]]
-	\| 1.620 kb/539aa, Chr. IV, <font color = red>inviable</font color>	+	\| 1.620 kb/539aa, Chr. IV, <font color = red>inviable</font color>
		+	\|
		+	\|
	\|}		\|}
	{\| border="1"		{\| border="1"
	! Tra1 subunit		! Tra1 subunit
-	! size, chromosome, null p-type	+	! size, chromosome, null p-type
		+	! deletion strain
		+	! genotype
	\|-		\|-
	\| Tra1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TRA1]]		\| Tra1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=TRA1]]
	\| 11.235 kb/3744aa, Chr. VIII, <font color = red>inviable</font color>		\| 11.235 kb/3744aa, Chr. VIII, <font color = red>inviable</font color>
		+	\|
		+	\|
	\|}		\|}
	{\| border="1"		{\| border="1"
	! other subunits		! other subunits
	! size, chromosome, null p-type		! size, chromosome, null p-type
		+	! deletion strain
		+	! genotype
	\|-		\|-
	\| Sgf73 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf73]]		\| Sgf73 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf73]]
-	\| 1.974 kb/657aa, Chr. VII , viable	+	\| 1.974 kb/657aa, Chr. VII , viable
		+	\|
		+	\|
	\|-		\|-
	\| Sgf29 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf29]]		\| Sgf29 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf29]]
-	\| 0.779 kb/259aa, Chr. III, viable	+	\| 0.779 kb/259aa, Chr. III, viable
		+	\|
		+	\|
	\|-		\|-
	\| Sgf11 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf11]]		\| Sgf11 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=sgf11]]
-	\| 0.3 kb/99aa, Chr.XVI, viable	+	\| 0.3 kb/99aa, Chr.XVI, viable
		+	\|
		+	\|
	\|-		\|-
	\| Ubp8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ubp8]]		\| Ubp8 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=ubp8]]
-	\| 1.416 kb/471aa, Chr. XIII, viable	+	\| 1.416 kb/471aa, Chr. XIII, viable
		+	\|
		+	\|
	\|-		\|-
	\| Sus1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Sus1]]		\| Sus1 [[http://db.yeastgenome.org/cgi-bin/locus.pl?locus=Sus1]]
	\| gene with intron, Chr. II, viable		\| gene with intron, Chr. II, viable
		+	\|
		+	\|
	\|}		\|}
	==SWI/SNF subunits==		==SWI/SNF subunits==