User:Nkuldell/other rewrites

From OpenWetWare

< User:Nkuldell
Revision as of 20:07, 16 July 2010 by Nkuldell (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Contents

spt6:URA3

To replace 704-1055 with URA3 marker from pRS406

  • SPT6 from 704-744: 5'- CTGGTCTATCGTCGGATAAGATTGACGAGATGTATGACAT
  • fwd URA3: 5' AGATTGTACTGAGAGTGCAC
  • SPT6 from 1015-1055: 5' ATGTCATCGGAGGATCAAGAATTAGAAAGAAACTGGATAG
  • rev complement SPT6 (from 1055-1015): 5'- 5'- CTA TCC AGT TTC TTT CTA ATT CTT GAT CCT CCG ATG ACA T
  • rev URA3: 5' CTGTGCGGTATTTCACACCG

spt6:URA3_704_1055_fwd

5' CTGGTCTATCGTCGGATAAGATTGACGAGATGTATGACATAGATTGTACTGAGAGTGCAC

spt6:URA3_704_1055_rev

5' CTGTGCGGTATTTCACACCGCTA TCC AGT TTC TTT CTA ATT CTT GAT CCT CCG ATG ACA T


ideas

  • stepwise move centromere from one end of chromosome to other
  • progressively larger deletions from telomere to first essential gene on each chromosome
  • clustering highly expressed genes on one arm, poorly expressed genes on other
  • clustering related genes into "operon"
  • multiple copies of yeast mating locus
  • replace S. cerevisiae genes for single complex (e.g. SAGA) with homologs from other yeast starting with pombe
  • in vivo reporter for transciption elongation: functional RNA?
  • randomize sigma 4.2 region of TFG2 and screen library for rifS and FLO:HIS mutants
  • check Drew's T7.1 for revertants that increase plaque size back to normal.
  • biobrick assembly for yeast parts (look at Pam's yeast parts first!)...ideally would use homologous recomb vs restriction sites
Personal tools