User:Rachel Mary Jones/Notebook/Biology 210 at AU

3/4/2016

This week we completed the zebrafish experiment. All of our fish died before the completion of the experiment. Today we observed the preserved control and nicotine specimens under a microscope more carefully. One major observation that we noted was the curve in the spine of the nicotine samples. This was not present in the control group. Additionally, the nicotine group had a grayish coloring that was not observed in the control group.

Preserved Samples: Nicotine: https://www.instagram.com/p/BDGDsQ0IoIa/?taken-by=rjbio210 Control: https://www.instagram.com/p/BDGDvmYIoIi/?taken-by=rjbio210

After observing these samples we carefully discarded the contaminated materials

2/26/16

This week, we continued our zebra fish experiments. On 2/26/16, we checked the developed embryos and found that from the 20 embryos in the nicotine group, 3 developed into living zebra fish. In the control group, of the 20 fish embryos, 3 developed into live zebra fish. This is significant as after a week, 50% of the control group survived and only 15% of the experimental group. There was a small difference in eye diameter but the difference in node chord length between the control group and the nicotine group was noticeable with 3 mm for the length of the control group and 2 mm for the node chord length of the nicotine group. After making these observations, we cleaned the environments that the embryos were housed in. This was to prevent build up of mold or other harmful factors. The living zebra fish were each given 15 um of shrimp brine for food. Additionally, one living fish from each group was preserved in formaldehyde. Therefore at the end of the lab on Friday 2/26/16 there was still 2 subjects in the test group and 9 subjects in the control group.

2/26/16: Nicotine embryo https://www.instagram.com/p/BChVY9AooBq/?taken-by=rjbio210 2/26/16 Control group embryo https://www.instagram.com/p/BChVkuSooBz/?taken-by=rjbio210

2/29/16 last living control group embryo https://www.instagram.com/p/BChWGesooCX/?taken-by=rjbio210

Additionally, we looked at the sequencing from our transect data. However as with many of the other transects, out transect did not result with any viable data. However there was data from transect 3 last semester that we had access to.

This data is:

10^-3 Sequence: NNNNNNNNNNGNNGCNNNNNTGCAGTCGAACGGGGTANGCGTAANGCTGCTNCTAGAGGGGGAGAGGGGTGCGTGAGGGC NNAGCGTCTGACTGACCGCGGGAGAGGGGTTGAAANAGGAACGCTAAAACCATGAACGTCACAGAGGAAAAGGCGGGAGA CGGTGGCCTTTTGCTCTATTTAATGATNATGGGTGGGAGCCCGAGANGGTGGTGGTNNTCNCCGTAANGGNAAGATGTAT ATGGGGTCAGAGAANAAGCTNAGACNCAGAGAAACTGAGACAGCGTCCAGACTCATACGGGGGGNGGGTGTGGAATTTGG GGCAATGGGGGAAAGGGCCATATCCAGCCGTGCCGCGTGTGCGAAGAACGCCTGAGTTTTGCCCTGCTTTTTGTCTTGNG ATGAAGGCCAGGAATAAAATATTCTACNCTTGTGATTCTGACTGTACAAAAAGAATAAGGACCGGCTAACTCCGTGCCCG CAGCCGCGGTAATACGGAGGATGCTAGCGTTATTCAGATTTATTGGGTTTAACGCGTGCGTATGCGGTCTTTTAATTCAA TGGTCAAATACTCTACCTCAACTGTCGCATTGCCTTTGATACTGTAGTACTTGAGTCTGTTTGANGTGNGTGCAATTACA CGTGTAACGGTGATATNCATANATATGTCNNGGANCTCCNATTGCGNNNGCCTCTCCCTANNCTNNCACTGACGCTNATG CACGAANGNNNNNGGATCGAACAGGATTACATACNCTCNNNNNCCACNCCCTANACAATTATAACTTGATGTTTGNNAAG ACAAAANNCTNCCCNCCCNCCCCAANCNTTTNNTTNNTNNNCCTNNGGAGGAGGNNCNCCCNGGTGAANACTCNNNNGNN TTTNNNNNCNGNCNNCACNCNCNCANNANNNGNNNNNNNNNNNNNNTNATACNNNAANNAACCNTGCNNCCCCTCCTTNN NNNNNGGGGGNNGNGGANAANNANNNNNNNNNNGNTNNNNNNNNNNANGANGNAANNNNNNNNNGGNGGGGNNNNNNNNN NNNNNNNTNTTNNTANNNNNANNNGGNGNNNNNANCNNCNNNNNGTNNNNN

10^-3 tet Sequence: NNNNNNNNNCNTANNNTGCAGTCGTANCAANGTAGCCNNNNNNTCCTGGCGGCGAGTGGCGAACGGGTGAGTAATACATC GGAACGTGCCCAATCGTGGGGGATAACGCAGCGAAAGCTGTGCTAATACCGCATACGATCTACGGATGAAAGCAGGGGAT CGCAAGACCTTGCGCGAATGGAGCGGCCGATGGCAGATTAGGTAGTTGGTGAGGTAAAGGCTCACCAAGCCTTCGATCTG TAGCTGGTCTGAGAGGACGACCAGCCACACTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATT TTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACTGCTTTTGTACGG AACGAAACGGCCTTTTCTAATAAAGAGGGCTAATGACGGTACCGTAAGAATAAGCACCGGCTAACTACGTGCCAGCAGCC GCGGTAATACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATGTAAGACAGTTGTG AAATCCCCGGGCTCAACCTGGGAACTGCATCTGTGACTGCATAGCTAGAGTACGGTAGAGGGGGATGGAATTCCGCGTGT AGCAGTGAAATGCGTAGATATGCGGAGGAACACCGATGGCGAAGGCAATCCCCTGGACCTGTACTGACGCTCATGCACGA AAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGTCAACTGGTTGTTGGGTCTTCACTG ACTCANTAACNAAGCTAACGCGTGAAGTTGACCGCCTGGGGAGTACGGCCGCAAGGTTGAAACTCAAGGAATTGACGGGG ACCCGCACNAACGGTGGATGATGTGGTTTAATTCNATGCAACNCNAAAAACCTTACCCACCTTTGACATGTACGGAATTC NNCAGANNTNGCTTANGGCTCNAANNANAACCGTTACACNGNTGCTGCATGGNNGTCNTCAGCTCGTGTCNNGAGNNNNT NGGGNTAANTCCCGNAACNAGCNCNNACCCNNTGNNN

The 10^-3 concentration with tet indicates a positive result and links this transect to Variovorex Paradoxus. Which is gram negative and an important factor in the biodegradation in nature.

This tet sequence was found in Liam Purdy's lab notebook.

2/19/2016

In this lab, we began a new expirament using zebra fish embryos. My lab partner and I chose to examine the effects of nicotine of the developing embryos. Our hypothesis is that the embryos with nicotine with have smaller notechord length and eye diamter and a quicker startle response than the zebrafish that were not exposed to nicotine. This assumption was based off of a study we read that conducted a similar experiment on zebra fish over the course of 10 days. Although our experiment will be over 7 days, we expect similar results

Procedure: We gathered 40 zebra fish embryos and 2 24 well well-plates. 20 of the embryos were placed in the control well plate. Each embryo was placed in 2 ml of water. In the other well-plate, the other 20 embryos were placed in individual wells with 2 ml of nicotine. Each embryo was examined under the microscope to make sure that they were at similar devlopmental stages. All embryos were around 18 hours old. These well-plates were placed on a tray and left undistrubed.

On monday 2/22/16, the embryos were examined under a microscope and any bacteria was removed from the well-plates. Some of the embryos had hatched. Control group:https://www.instagram.com/p/BCPUxwAooEV/?taken-by=rjbio210 Nicotine group: https://www.instagram.com/p/BCPUpheooEL/?taken-by=rjbio210

On Tuesday 2/23/16, the embryos were examined again and any bacteria and shell casings were removed.

On Wednesday 2/24/16 the embryos were examined again and fed 15 ul of shrimp brine. Several embryos had hatched and were swimming in their enviornments. There were no casualties, however the nicotine zebrafish appeared to have less motion than the nicotine fish. Additionally, the nicotine fish looked as their they had not developed as much as the control fish. Their eye diameter in particular looked stunted.

Control Group:https://www.instagram.com/p/BCPUdGKooD7/?taken-by=rjbio210 Nicotine group:https://www.instagram.com/p/BCPUhMHIoEC/?taken-by=rjbio210

2/12/2016

Today we created slides from samples of our Berlese Funnel and examined them under a microscope to identify the invertebrates. In our first sample from the funnel, which was created from the liquid on the surface, we saw only 1 invertebrate. We identified this as a big brown miter. We only saw one of them in our sample and it had a clear body, head, 4 legs and hair on its back. Big brown mite: https://www.instagram.com/p/BB-JB_ZooNq/?taken-by=rjbio210

In the sample from the bottom of the funnel, we identified 2 invertebrates. The first was Annelida Amelida. We saw 3 of these in the sample. This appeared to be a worm with a visible digestive tract and a long body.

Table of observed invertebrates https://www.instagram.com/p/BB-GXAkIoJK/?taken-by=rjbio210

Annelida Amelida: https://www.instagram.com/p/BB-GBXxIoIk/?taken-by=rjbio210

We also identified diplopoda in the sample from the bottom. This had a long body with many little legs and a visible head.

Diploda: https://www.instagram.com/p/BB-GEk2IoIp/?taken-by=rjbio210

Food Web

See image for a food web from transect 3 created from observed biotic and abiotic life.

https://www.instagram.com/p/BB-HhkxooLW/?taken-by=rjbio210

Birds (vertebrates): -Robin -Finch -Cardinal

Invertebrates: Maggots Diploda Beatles

Earthworm (Annelida Amelida)

Dead/ Alive leaves

Dead animals (not observed but inferred)

The energy from this system flows when one organism eats another and nutrients cycle through the system. The community structure of this transect is based on the number of species, their abundance and interactions and the physical attributes of the community. These species interact by consuming each other and living together in this small transect. The carrying capacity is the max population that an environment can sustain of a population. The carrying capacity for the invertebrates, and abiotic life is high. However there is a smaller limit for vertebrates such as the birds, and overpopulation of robins, cardinals or finches would have serious consequences. The trophic level of an organism is the level it occupies on the food chain. In this transect, since there are no known predators to the birds, they would occupy the top of the food chain. Next would be the invertebrates that feed off the environment.

1/15/2016

Transect 3

Description: This transect is located in the garden area at american university. It contains both abiotic and biotic life. The area has 3 sections of garden with 2 walkways and 3 benches throughout

abiotic life: Trees: 8 tall trees, 7 short trees Bushes: 16 long grassy brown bushes shrubs: 14 short interwoven bushes throughout no rocks

Biotic life -1 birds nest in a tree -1 squirel on the ground

See photo for transect diagram

After observing the transect various samples of nature were collected and used to form a hay infusion, this hay infusion was left to process over the course of a week

1/29/16

Note: all images for this lab are available at https://www.instagram.com/rjbio210/

Instagram: RJBIO210

In this week’s lab, we used the Agar plates to identify and study bacteria.

Hay Infusion observation: The water in the hay infusion is a stagnant murky brown. It has a bit of a musty smell. Sediment has settled around the sides of the infusion as well as at the bottom. I suspect that the smell has worsened due to the growth of the bacteria in the infusion.

Agar plate observations: As I was in a different lab last week, I am catching up on observing the Agar plates. There appears to be bacterial growth on most of the plates (except 10^-7), even with the antibiotics. Two of the plates have dark black growth, however this is due to them being created on blood agar plates. The rest of the Agar plates have yellow and white clusters of bacteria. When the lid of the agar plates are removed, there is a very foul smell coming from the bacteria.

Some different observations: -On the 10^-3 plate, there are spiral colonies and a lot of development -On the 10^-5 plate there are the yellow and white bacteria as on other plates, but there is also what appears to be blue colored bacteria which is unusual.

https://www.instagram.com/p/BBaESFZooKX/?taken-by=rjbio210 https://www.instagram.com/p/BBaEQ_4IoKT/?taken-by=rjbio210 https://www.instagram.com/p/BBaEPqNooKQ/?taken-by=rjbio210 https://www.instagram.com/p/BBaEejhIoKu/?taken-by=rjbio210 https://www.instagram.com/p/BBaEiNjooK4/?taken-by=rjbio210 https://www.instagram.com/p/BBaEjlZIoK9/?taken-by=rjbio210 https://www.instagram.com/p/BBaElf2ooLH/?taken-by=rjbio210 https://www.instagram.com/p/BBaEo8XIoLO/?taken-by=rjbio210

There are different clusters and colonies of bacteria on the agar plates. The most on the 10^-3 without tet plate. As the dilution gets stronger, we see less and less colonies. We can also see that plates with the antibiotic had significantly fewer colonies, indicting that the antibiotic has an effect. The fact that bacteria still grew all the way up to 10^-5 dilution with tetracycline, indicts this is bacteria that is somewhat resistant to antibiotics.

Determine the mechanisms of action for tetracycline and the types of bacteria that are sensitive to this tetracycline. Cite your sources! Tetracylines are inexpensive antiobiotics often used in humans and animals. It works by going through the cell membrane and attacking the bacteria. Bacteria that have become resistant to tetracyline have often aquired new genes and a coding for a protien which blocks, the Tet from being able to get through the membrane.

Source: Chopra, I., & Roberts, M. (2001). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiology and Molecular Biology Reviews, 65(2), 232–260. http://doi.org/10.1128/MMBR.65.2.232-260.2001

Wet mount observations (see images) there were smaller clusers of bacteria in the wet mounts. https://www.instagram.com/p/BBaEY-tIoKp/?taken-by=rjbio210 https://www.instagram.com/p/BBaEb0HIoKr/?taken-by=rjbio210

Gram Stain observations: Samples from 10^-3 with tete, 10^-7 , 10^-5 with tet and 10^-7 with tet were created and observed under the microscope. All of these slides showed different types of bacteria growth. In the 10^-3 plate at 40x it looked like muscle tissue but when enhanced, there were small clusters of tightly grouped bacterial colonies. In the 10^-7 without tet, there was a flowing river of bacteria in the middle of the plate. (see images) https://www.instagram.com/p/BBaGmn5ooPS/?taken-by=rjbio210 https://www.instagram.com/p/BBaEWjWooKg/?taken-by=rjbio210 https://www.instagram.com/p/BBaETD7IoKZ/?taken-by=rjbio210

1/5/16

For this week’s lab we revisited the transect to collect new samples and observations. We collected 5 different samples of plants and using field guides, the Internet and our observations, we were able to classify them.

We observed: 1) American Holly https://www.instagram.com/p/BBakzyIooNG/?taken-by=rjbio210 2) Tulip Leaves https://www.instagram.com/p/BBaky4qIoND/?taken-by=rjbio210 3) Common Reid https://www.instagram.com/p/BBakyIEIoNC/?taken-by=rjbio210 4) Fountain Grass https://www.instagram.com/p/BBakxRwooNA/?taken-by=rjbio210 5) Chinese Holly https://www.instagram.com/p/BBsLBtzooLn/?taken-by=rjbio210

See links for images describing plant characteristics, height, vascularization and mechanisms for sexual reproduction.

In our transect, we did not observe any seeds, however we did dissect the Chinese holly berries

We also collected a large bag full of scattered leaves from the transect, to perform a Berlese Funnel. Next week, we will examine the findings of this funnel.

What are Fungi sporangia and why are they so important? Fungi are unicellular eukaryotes that are crucial to ecosystems. Fungi act as decomposers. They release carbon dioxide into the air and nitrogen into soil and water.