User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert

From OpenWetWare

< User:S Sibert | Notebook(Difference between revisions)
Jump to: navigation, search
(4/25/13)
Current revision (17:20, 1 December 2013) (view source)
 
(19 intermediate revisions not shown.)
Line 13: Line 13:
|-  
|-  
|colspan="2"|
|colspan="2"|
-
==SSB13 140L Vanillin synthon - CCOMT-2==
 
-
 
-
* Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT<br>GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA<br>TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG<br>TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG<br>CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT<br> 397 >Medicago sativa caffeic acid methyltransferase bin 2
 
-
 
-
==Notes==
 
-
* Need to use Eco-Bam for digestion
 
-
* Pieces given:
 
-
CCOMT-2_oligo_1         AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA <br>
 
-
CCOMT-2_oligo_2         AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC <br>
 
-
CCOMT-2_oligo_3         AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG <br>
 
-
CCOMT-2_oligo_4         ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT <br>
 
-
CCOMT-2_oligo_5         ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT <br>
 
-
CCOMT-2_oligo_6         ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT <br>
 
-
CCOMT-2_oligo_7         CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT <br>
 
-
CCOMT-2_oligo_8         CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT <br>
 
-
CCOMT-2_oligo_9         GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC <br>
 
-
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG <br>
 
-
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT <br>
 
-
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT <br>
 
-
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG <br>
 
-
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC <br>
 
-
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT <br>
 
-
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC <br>
 
-
<br>
 
-
* Predicted PCR Product:
 
-
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT<br>GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT<br>AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG<br>TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA<br>GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT<br><br>
 
-
 
-
 
-
 
-
==Construction File==
 
-
PCA CCOMT-2  oligos 1-16, PCA1 [[Template:SBB-PCA]]      (457, pca1)<br>
 
-
PCR pca1 with universalFwd/universalRev, PCA2            (457, pca2)<br>
 
-
Digest pca2 with EcoRI/BamHi (changed from BglII), gp  (412+26+19 bp, pcr_dig)<br>
 
-
(get pre-digested vector from JCA of pBca9145-Bca1144  (EcoRI/BamHI, vect_dig)<br>
 
-
Ligate pcr_dig and vect_dig,2469bp,  transform, pick white colonies, map, sequence<br>
 
-
 
-
 
-
>Well Position, Name,Sequence
 
-
>E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA <br>
 
-
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC <br>
 
-
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG <br>
 
-
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT <br>
 
-
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT <br>
 
-
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT <br>
 
-
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT <br>
 
-
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT <br>
 
-
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC <br>
 
-
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG <br>
 
-
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT <br>
 
-
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT <br>
 
-
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG <br>
 
-
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC <br>
 
-
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT <br>
 
-
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC <br>
 
-
>A5, universalFwd ATATAGATGCCGTCCTAGC<br>
 
-
>B5, universalRev AAGTATCTTTCCTGTGCCCA<br>
 
-
 
-
>PCA1/2<br>
 
-
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA<br>
 
-
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT<br>
 
-
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA<br>
 
-
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA<br>
 
-
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA<br>
 
-
AAGATACTT
 
-
 
-
>final product<br>
 
-
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA<br>
 
-
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA<br>
 
-
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG<br>
 
-
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT<br>
 
-
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc<br>
 
-
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa<br>
 
-
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag<br>
 
-
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc<br>
 
-
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag<br>
 
-
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac<br>
 
-
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg<br>
 
-
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt<br>
 
-
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga<br>
 
-
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga<br>
 
-
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga<br>
 
-
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata<br>
 
-
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa<br>
 
-
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt<br>
 
-
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc<br>
 
-
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca<br>
 
-
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt<br>
 
-
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg<br>
 
-
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt<br>
 
-
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc<br>
 
-
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt<br>
 
-
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct<br>
 
-
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa<br>
 
-
ggatgatttctg
 
-
 
-
==3/3/12==
 
-
PCA 1 with contents of CCOMT-2 tube.
 
-
 
-
==3/12/13==
 
-
[[Template:SBB-Protocols_Zymo1]]<br>
 
-
 
-
[[Template:SBB-PCA]] Amplification Step<br>
 
-
 
-
Digest Eco/Bam
 
-
 
-
Given to Jon to run program
 
-
 
-
==3/13/13==
 
-
GEL RUN<br>
 
-
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.<br>
 
-
 
-
My sample is the third sample (lane 5)<br>[[Image:2013_03_13-JCA-gel1.jpg]]
 
-
 
-
 
-
==3/14/13==
 
-
[[Template:SBB-Protocols_Zymo1]]
 
-
Ran gel, cut, melted in zymo buffer. Froze before column step.
 
-
 
-
==3/19/13==
 
-
Zymo column
 
-
 
-
==3/21/13==
 
-
ligate [SBB-Protocols_Enz4]<br>
 
-
transform<br>
 
-
used PCR tubes to fit in incubator.
 
-
 
-
==4/2/13==
 
-
only 3 colonies in my plate. Only 2 colonies from class had reasonable results. <br>
 
-
Run gel on digest from 3/14/13. With Wells at the top, counting from left to right, lane 3. Gel 2. <br>
 
-
Set up new digest from pcr products in tube labeled 3/12/13<br>
 
-
started incubation at 10:40<br>
 
-
removed from incubator 11:40<br>
 
-
zymo cleanup column<br>
 
-
 
-
==4/4/13==
 
-
Ligations
 
-
6.5uL ddH2O
 
-
1uL Ligation buffer
 
-
1uL vector
 
-
1uL insert
 
-
0.5uL enzyme (last)
 
-
 
-
Comp Cells
 
-
1 tube cells
 
-
30uL KCM
 
-
(no ddH2O)
 
-
 
-
==4/9/13==
 
-
no colonies in new plate, 3 colonies in old plate will be used to proceed.
 
-
 
-
picked colonies. by ejecting pipet tip into tube.
 
-
 
-
==4/11/13==
 
-
1)miniprep culture<br>
 
-
2) restriction map EcoRI/XhoI<br>
 
-
6ul H2O<br>
 
-
1ul buffer<br>
 
-
2ul DNA<br>
 
-
0.5ul XhoI<br>
 
-
0.5ul EcoRI<br>
 
-
put in thermo cycler 11:23<br>
 
-
3) run a gel<br>
 
-
Lane 7-Sample A<br>
 
-
Lane 8-Sample B<br>
 
-
Lane 9-Sample C<br>
 
-
 
-
4) No results.<br>
 
-
 
-
==4/16/13==
 
-
Starting with <br>
 
-
50ul rxn<br>
 
-
31.5 ul H20<br>
 
-
5ul dNTP<br>
 
-
10ul Phusion buffer<br>
 
-
1ul template (sample from 3/12/13)<br>
 
-
1ul 10mm oligo 1 (CCOMT2-3 diluted)<br>
 
-
1ul 10mm oligo 2 (CCOMT2-4 diluted)<br>
 
-
0.5ul Phusion<br>
 
-
 
-
 
-
Tube placed in thermocycler labeled ccomt2 4/16/13
 
-
 
-
 
-
 
-
Golden Gate Set up:<br>
 
-
(n)ul ddH2O to 10ul<br>
 
-
1ul Ligase Buffer<br>
 
-
0.5ul Ligase<br>
 
-
0.5ul BsmB1<br>
 
-
1ul PER CONSTRUCT<br>
 
-
0.5ul vertor<br>
 
-
 
-
==4/18/2013==
 
-
sample processed by jc anderson to miniprep step <br>
 
-
miniprep<br>
 
-
 
-
==4/19/2012==
 
-
sequence confirmed<br>
 
-
golden gate<br>
 
-
Protocol:<br>
 
-
6.5ul ddH2o<br>
 
-
1ul ligase buffer<br>
 
-
0.5ul ligase<br>
 
-
0.5ul BsMb1<br>
 
-
1ul of synthon mic<br>
 
-
o.5ul vector<br>
 
-
 
-
==4/23/13==
 
-
 
-
Transform<br>
 
-
1 tube<br>
 
-
20ul KCM<br>
 
-
no h20<br>
 
-
Rescue <br>
 
-
plate<br>
 
-
 
-
==4/25/13==
 
-
~miniprep~<br>
 
-
~map~<br>
 
-
5.5ul H20<br>
 
-
2ul Plasmid<br>
 
-
1ul NEB2<br>
 
-
0.5ul Bsa1<br>
 
-
1ul BSA<br>
 
-
 
-
 
-
~seq~<br>
 
-
 
-
|-
 
-
|colspan="2" style="background-color: #F2F2F2;"|
 
-
{{LnNotebookRecentChanges2}}
 
-
|}
 
-
 
-
__NOTOC__
 

Current revision

Search this Project

Customize your entry pages
Personal tools