User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Autocreated Lab Notebook name=User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert, content from MediaWiki:ProjectContentDefault)
(Project Description/Abstract)
Line 13: Line 13:
|-  
|-  
|colspan="2"|
|colspan="2"|
-
==Project Description/Abstract==
+
==SSB13 140L Vanillin synthon - CCOMT-2==
-
* Place short description of project or notes regarding this project
+
-
* Lorem ipsum dolor sit amet, consectetuer adipiscing elit. Donec porta commodo tellus. Nam a est eget libero mollis tincidunt. Aliquam purus. Quisque nulla ligula, facilisis in, pulvinar sed, molestie a, quam. Vestibulum at pede. In in sem eget odio eleifend placerat. Phasellus ultricies felis quis sapien. Etiam molestie volutpat quam. Praesent pulvinar scelerisque mi. Nam mi urna, fringilla eu, mattis sed, venenatis id, nunc. Maecenas velit eros, congue ut, placerat in, ornare vel, sem. Aenean porta enim sit amet felis gravida posuere. Phasellus faucibus nibh et orci.
+
* Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT 397 >Medicago sativa caffeic acid methyltransferase bin 2
==Notes==
==Notes==

Revision as of 16:00, 5 March 2013

Search this Project

Customize your entry pages

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT 397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Place some notes here for visitors
  • Example: This project is currently on hold until further notice.


Recent changes



Personal tools