User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Notes)
(Construction File)
Line 41: Line 41:
==Construction File==
==Construction File==
-
Mix oligos for one synthon, do PCA1 protocol              (bp, pca1)<br>
+
PCA CCOMT-2  oligos 1-16, PCA1 [[Template:SBB-PCA]]      (457, pca1)<br>
-
PCR pca1 with external oligos by PCA2 protocol           (bp, pca2)<br>
+
PCR pca1 with universalFwd/universalRev, PCA2            (457, pca2)<br>
-
Digest pca2 with EcoRI/BglII (yes, BglII), gp             (?+?+? bp, pcr_dig)<br>
+
Digest pca2 with EcoRI/BamHi (changed from BglII), gp   (412+26+19 bp, pcr_dig)<br>
(get pre-digested vector from JCA of pBca9145-Bca1144  (EcoRI/BamHI, vect_dig)<br>
(get pre-digested vector from JCA of pBca9145-Bca1144  (EcoRI/BamHI, vect_dig)<br>
Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence<br>
Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence<br>
 +
 +
 +
>Well Position, Name,Sequence
 +
>E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA <br>
 +
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC <br>
 +
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG <br>
 +
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT <br>
 +
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT <br>
 +
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT <br>
 +
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT <br>
 +
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT <br>
 +
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC <br>
 +
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG <br>
 +
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT <br>
 +
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT <br>
 +
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG <br>
 +
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC <br>
 +
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT <br>
 +
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC <br>
 +
>A5, universalFwd ATATAGATGCCGTCCTAGC<br>
 +
>B5, universalRev AAGTATCTTTCCTGTGCCCA<br>
 +
 +
>PCA1/2<br>
 +
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA<br>
 +
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT<br>
 +
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA<br>
 +
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA<br>
 +
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA<br>
 +
AAGATACTT
 +
 +
>final product<br>
 +
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA<br>
 +
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA<br>
 +
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG<br>
 +
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT<br>
 +
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc<br>
 +
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa<br>
 +
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag<br>
 +
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc<br>
 +
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag<br>
 +
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac<br>
 +
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg<br>
 +
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt<br>
 +
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga<br>
 +
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga<br>
 +
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga<br>
 +
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata<br>
 +
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa<br>
 +
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt<br>
 +
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc<br>
 +
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca<br>
 +
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt<br>
 +
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg<br>
 +
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt<br>
 +
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc<br>
 +
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt<br>
 +
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct<br>
 +
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa<br>
 +
ggatgatttctg

Revision as of 01:15, 7 March 2013

Search this Project

Customize your entry pages

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC

  • Predicted PCR Product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT
GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT
AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA
GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT

Construction File

PCA CCOMT-2 oligos 1-16, PCA1 Template:SBB-PCA (457, pca1)
PCR pca1 with universalFwd/universalRev, PCA2 (457, pca2)
Digest pca2 with EcoRI/BamHi (changed from BglII), gp (412+26+19 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence


>Well Position, Name,Sequence >E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
>A5, universalFwd ATATAGATGCCGTCCTAGC
>B5, universalRev AAGTATCTTTCCTGTGCCCA

>PCA1/2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA
AAGATACTT

>final product
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa
ggatgatttctg


Recent changes



Personal tools