User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert

From OpenWetWare

Jump to: navigation, search

Search this Project

Customize your entry pages

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATC
    ATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT 397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Place some notes here for visitors
  • Example: This project is currently on hold until further notice.


Recent changes



Personal tools