User:S Sibert/Notebook/SBB13Ntbk-Stephanie J Sibert

From OpenWetWare

Jump to: navigation, search

Search this Project

Customize your entry pages

SSB13 140L Vanillin synthon - CCOMT-2

  • Assigned Sequence: Stephanie Sibert CCOMT-2 GCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAAGGATGCAGTTTT
    GGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAA
    TAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
    TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTG
    CCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
    397 >Medicago sativa caffeic acid methyltransferase bin 2

Notes

  • Need to use Eco-Bam for digestion
  • Pieces given:

CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC

  • Predicted PCR Product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCAT
GGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTT
AATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGTCATTGA
GGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT


Construction File

PCA CCOMT-2 oligos 1-16, PCA1 Template:SBB-PCA (457, pca1)
PCR pca1 with universalFwd/universalRev, PCA2 (457, pca2)
Digest pca2 with EcoRI/BamHi (changed from BglII), gp (412+26+19 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig,2469bp, transform, pick white colonies, map, sequence


>Well Position, Name,Sequence >E7, CCOMT-2_oligo_1 AACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCA
>F7, CCOMT-2_oligo_2 AAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACC
>G7, CCOMT-2_oligo_3 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAATGTTCAACTCCTGG
>H7, CCOMT-2_oligo_4 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCT
>A8, CCOMT-2_oligo_5 ATATGAAGGGGCATCCTCAATGACATGTGGCAAATCAAAATTAATACCTTTAAT
>B8, CCOMT-2_oligo_6 ATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGT
>C8, CCOMT-2_oligo_7 CATAGTAATTGTAGAATGATCAGACATACCTTTATTAAAGACTTTATTAAATCT
>D8, CCOMT-2_oligo_8 CATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCAT
>E8, CCOMT-2_oligo_9 GATTCCACCGTCCAAAACTGCATCCTTCAAGTGATACCATGACTCCATTAAAAC
>F8, CCOMT-2_oligo_10 GCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTG
>G8, CCOMT-2_oligo_11 GCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGT
>H8, CCOMT-2_oligo_12 GTCGACTAAAGATTTTAAACCCTCAAAACCTGTATAAGTCTCTAATATTTTCTT
>A9, CCOMT-2_oligo_13 TGGATCAGTACCATGGTATTCAAAGGCGGTCATACCATAAGCCTTGTTAAAAGG
>B9, CCOMT-2_oligo_14 TGTAGGATACTTTGAAACAATTGTGTTAATAACAGCACCTGTTCCTCCACCAAC
>C9, CCOMT-2_oligo_15 TTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATT
>D9, CCOMT-2_oligo_16 TTTGTCTTGGTTCATTAAGTTTAAGGCAGAGATAGATGAGACGATGCAGATCTC
>A5, universalFwd ATATAGATGCCGTCCTAGC
>B5, universalRev AAGTATCTTTCCTGTGCCCA

>PCA1/2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAA
TGGAGTCATGGTATCACTTGAAGGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCAT
GGTACTGATCCAAGATTTAATAAAGTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACA
GGTTTTGAGGGTTTAAAATCTTTAGTCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAA
GGTATTAATTTTGATTTGCCACATGTCATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCTGGGCACAGGA
AAGATACTT

>final product
GAATTCATGAGATCTGCATCGTCTCATCTATCTCTGCCTTAAACTTAATGAACCAAGACAAAGTTTTAATGGAGTCATGGTATCACTTGAA
GGATGCAGTTTTGGACGGTGGAATCCCTTTTAACAAGGCTTATGGTATGACCGCCTTTGAATACCATGGTACTGATCCAAGATTTAATAAA
GTCTTTAATAAAGGTATGTCTGATCATTCTACAATTACTATGAAGAAAATATTAGAGACTTATACAGGTTTTGAGGGTTTAAAATCTTTAG
TCGACGTTGGTGGAGGAACAGGTGCTGTTATTAACACAATTGTTTCAAAGTATCCTACAATTAAAGGTATTAATTTTGATTTGCCACATGT
CATTGAGGATGCCCCTTCATATCCAGGAGTTGAACATTGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa
gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgag
catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtag
gtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg
gtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctt
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga
gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata
actacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataa
accagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt
aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattc
agctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca
gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt
gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg
ccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgc
cgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtct
aagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaa
ggatgatttctg

3/3/12

PCA 1 with contents of CCOMT-2 tube.

3/12/13

Template:SBB-Protocols_Zymo1

Template:SBB-PCA Amplification Step

Given to Jon to run program

3/13/13

GEL RUN
This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification.

My sample is the third sample (lane 5)
Image:2013_03_13-JCA-gel1.jpg


3/14/13

Template:SBB-Protocols_Zymo1 Ran gel, cut, melted in zymo buffer. Froze before column step.

3/19/13

Zymo column

3/21/13

ligate transform used PCR tubes to fit in incubator.

Recent changes



Personal tools