|
|
| Line 70: |
Line 70: |
| [[Image:Electrophoresis_GA_16.09.jpg|right|thumb|350px|Electrophoresis]] | | [[Image:Electrophoresis_GA_16.09.jpg|right|thumb|350px|Electrophoresis]] |
|
| |
|
|
| |
|
| |
| <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
| |
| |}
| |
|
| |
| __NOTOC__
| |
|
| |
| ==PCR for gDNA amplification==
| |
|
| |
| '''Product Size: 992 bp Pair Any: 6.0 Pair End: 2.0'''
| |
|
| |
| TAS2R38_gaF: ATCCGTGATGCTGTGCTATG
| |
|
| |
| Length: 20 bp Tm: 59.7 °C GC: 50.0 % ANY: 4.0 SELF: 0.0
| |
|
| |
| TAS2R38_gaR: GCATCCCAGAAGAAACCAGA
| |
|
| |
| Length: 20 bp Tm: 60.2 °C GC: 50.0 % ANY: 2.0 SELF: 0.0
| |
|
| |
|
| |
|
| |
| '''PCR 1'''
| |
|
| |
| [[Image:GDNA_PCR1.JPG]]
| |
|
| |
|
| |
| '''Agarose gel electrophoresis'''
| |
| * 0.7% agarose gel prepared
| |
| * 700 mg of agarose was added to water and heated at 600 °C for 90 seconds
| |
| * 10 mg gel red was added and mixed
| |
| * the gel mixture was added to the casting apparatus and comb was placed
| |
| * 450 ml TAE buffer was poured to the electrophoretic chamber
| |
| * After the gel was set, it was transferred to the electrophoretic chamber
| |
| * the comb was slowly taken out
| |
| * Sample mixtures (5μL water + 2μL loading dye + 5μL PCR product / 2μL DNA ladder) were loaded to individual wells and the chamber was covered
| |
| * electrophoresis was run at 120 V for 30 minutes
| |
|
| |
| [[Image:Electrophoresis_GA_04.09.jpg|right|thumb|350px|Electrophoresis]]
| |
|
| |
|
| |
| Observations
| |
| * first few samples including 100 bp ladder are invisible
| |
| * 1 kb ladder does not show distinct bands
| |
| * All the PCR products are seen below 250bp and are diffused
| |
| * Desired region of the genomic DNA was not amplified
| |
|
| |
|
| |
|
| |
|
| |
|
| |
| '''PCR 2'''
| |
|
| |
| * Amount of Phusion polymerase was changed
| |
| * Annealing temperature was decreased
| |
| * Taq DNA polymerase was also used
| |
|
| |
| [[Image:GDNA_PCR2.JPG]]
| |
| [[Image:Electrophoresis_GA_05.09.jpg|right|thumb|350px|Electrophoresis]]
| |
| [[Image:Electrophoresis_GA_15.09.jpg|right|thumb|350px|Electrophoresis]]
| |
| '''Agarose gel electrophoresis'''
| |
| * 0.7% agarose gel prepared
| |
| * 700 mg of agarose was added to water and heated at 600 °C for 90 seconds
| |
| * 10 mg gel red was added and mixed
| |
| * the gel mixture was added to the casting apparatus and comb was placed
| |
| * 450 ml TAE buffer was poured to the electrophoretic chamber
| |
| * After the gel was set, it was transferred to the electrophoretic chamber
| |
| * the comb was slowly taken out
| |
| * (5μL water + 2μL loading dye + 5μL PCR product / 2μL DNA ladder)
| |
| Sample mixtures were loaded to individual wells and the chamber was covered
| |
| * electrophoresis was run at 120 V for 30 minutes
| |
|
| |
|
| |
|
| |
|
| |
| Observation
| |
| * Phusion polymerase could not amplify the desired region of DNA
| |
| * Two bands were observed for Taq polymerase: one at about 1000bp and the other below 250bp
| |
| * Amplifiction was successful with taq DNA polymerase
| |
| * however, the bands are unclear and diffused
| |
| * reason for unclear and diffused bands may be the composition of agarose gel as it was prepared just in water
| |
|
| |
|
| |
| '''Agarose gel electrophoresis (repeated)'''
| |
| * agarose gel was prepared in TAE buffer and the samples were run
| |
|
| |
|
| |
|
| |
| Observation
| |
| * bands look much clear and distinct
| |
| * PCR products of Taq DNA polymerase show bands at 1kbp which was estimated (992 bp)
| |
| * blank with Phusion DNA polymerase shows a thin band and that with Taq DNA polymerase shows a discinct and below 100 bp. These bands could not be primer dimers as they could only be as long as 40bp.
| |
| * unspecific bands/products were also seen in other samples
| |
|
| |
| '''DNA concentration'''
| |
|
| |
| 1. T3: 520.9 ng/μL (260:280=1.79)
| |
|
| |
| 2. N3: 406.7 ng/μL (260:280=1.83)
| |
|
| |
| - Samples T3 and N3 were sent for sequencing
| |
|
| |
|
|
| |
|
Project name
