User:Saroj Pandey/Notebook/SNP PCR optimization/2014/09/18

From OpenWetWare
Jump to navigationJump to search
Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

gDNA extraction from buccal cavity

Tissue Preparation

1. Gargle with 14 ml 0.9% NaCl. Apply toothbrush to the inner lining of buccal cavity. Collect the tissue suspension in a tube.

2. Centrifuge at 5000 rpm for 20 minutes.

3. Discard supernatant and transfer pellet in a 1.5 ml eppendorf tube. Add 0.9% NaCl to make up the volume to 1.5 ml.

4. Centrifuge at 12000 rpm for 4 minutes.

5. Discard supernatant and use pellet for DNA extraction.


DNA extraction (Ron's Tissue DNA Mini Kit)

1. Add 250 µl buffer PB incl. 20 µl proteinase K. Vortex thoroughly at max. speed for 15 s.

2. Incubate the tube at 52°C for 45 min. Vortex occasionally.

3. Add 250 µl buffer AB and vortex for 5 s. Transfer solution to a spin column by pipetting.

4. Centrifuge loaded column at 13000 rpm for 30s. Discard flow-through.

5. Add 400 µl buffer WB to the spin column. Centrifuge at 13000 rpm for 30s. Discard flow-through.

6. Wash the spin column with 400 µl 70% ethanol by centrifugation at 13000 rpm for 3 min. Carefully remove the tube and discard flow-through.

7. Transfer the column to a 105 ml tube. Place 100 µl buffer EB preheated to 70°C in the centre of the column, close the lid and incubate for 1 min. Centrifuge at 13000 rpm for 1 min to elute DNA.



DNA concentration

1. Taster: 58.3 ng/μL (260:280 - 1.77)

2. Non-taster: 25.7 ng/μL (260:280 - 1.74)

PCR for gDNA amplification

Product Size: 992 bp Pair Any: 6.0 Pair End: 2.0

TAS2R38_gaF: ATCCGTGATGCTGTGCTATG

Length: 20 bp Tm: 59.7 °C GC: 50.0 % ANY: 4.0 SELF: 0.0

TAS2R38_gaR: GCATCCCAGAAGAAACCAGA

Length: 20 bp Tm: 60.2 °C GC: 50.0 % ANY: 2.0 SELF: 0.0


PCR 1


Agarose gel electrophoresis

  • 0.7% agarose gel prepared
  • 700 mg of agarose was added to water and heated at 600 °C for 90 seconds
  • 10 mg gel red was added and mixed
  • the gel mixture was added to the casting apparatus and comb was placed
  • 450 ml TAE buffer was poured to the electrophoretic chamber
  • After the gel was set, it was transferred to the electrophoretic chamber
  • the comb was slowly taken out
  • Sample mixtures (5μL water + 2μL loading dye + 5μL PCR product / 2μL DNA ladder) were loaded to individual wells and the chamber was covered
  • electrophoresis was run at 120 V for 30 minutes
Electrophoresis


Observations

  • first few samples including 100 bp ladder are invisible
  • 1 kb ladder does not show distinct bands
  • All the PCR products are seen below 250bp and are diffused
  • Desired region of the genomic DNA was not amplified



PCR 2

  • Amount of Phusion polymerase was changed
  • Annealing temperature was decreased
  • Taq DNA polymerase was also used

Electrophoresis
Electrophoresis

Agarose gel electrophoresis

  • 0.7% agarose gel prepared
  • 700 mg of agarose was added to water and heated at 600 °C for 90 seconds
  • 10 mg gel red was added and mixed
  • the gel mixture was added to the casting apparatus and comb was placed
  • 450 ml TAE buffer was poured to the electrophoretic chamber
  • After the gel was set, it was transferred to the electrophoretic chamber
  • the comb was slowly taken out
  • (5μL water + 2μL loading dye + 5μL PCR product / 2μL DNA ladder)

Sample mixtures were loaded to individual wells and the chamber was covered

  • electrophoresis was run at 120 V for 30 minutes



Observation

  • Phusion polymerase could not amplify the desired region of DNA
  • Two bands were observed for Taq polymerase: one at about 1000bp and the other below 250bp
  • Amplifiction was successful with taq DNA polymerase
  • however, the bands are unclear and diffused
  • reason for unclear and diffused bands may be the composition of agarose gel as it was prepared just in water


Agarose gel electrophoresis (repeated)

  • agarose gel was prepared in TAE buffer and the samples were run


Observation

  • bands look much clear and distinct
  • PCR products of Taq DNA polymerase show bands at 1kbp which was estimated (992 bp)
  • blank with Phusion DNA polymerase shows a thin band and that with Taq DNA polymerase shows a discinct and below 100 bp. These bands could not be primer dimers as they could only be as long as 40bp.
  • unspecific bands/products were also seen in other samples

DNA concentration

1. T3: 520.9 ng/μL (260:280=1.79)

2. N3: 406.7 ng/μL (260:280=1.83)

- Samples T3 and N3 were sent for sequencing



Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Saroj_Pandey/Notebook/SNP_PCR_optimization/2014/09/18&oldid=821970"