User:Saroj Pandey/Notebook/SNP PCR optimization/2014/11/14: Difference between revisions
Saroj Pandey (talk | contribs) (Autocreate 2014/11/14 Entry for User:Saroj_Pandey/Notebook/SNP_PCR_optimization) |
Saroj Pandey (talk | contribs) |
||
Line 6: | Line 6: | ||
| colspan="2"| | | colspan="2"| | ||
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | ||
== | ==Final separation and gradient PCR== | ||
'''PTC taster and non-taster separation''' | |||
Two primer pairs were taken so that the PTC taster and non-taster could be separated. | |||
[[Image: SeparationPCR_14.11.jpg|right|thumb|400px|Separation PCR]] | |||
[[Image: SeparationPCRelec_14.11.jpg|right|thumb|400px|electrophoresis]] | |||
Taster specific primer pair: | |||
EP9_F: AGCTATGCCCCCTTTCCTCT | |||
Cfb(R): CAATCACTGTTGCTCAGTGG | |||
Product size: 911bp | |||
Non-taster specific primer pair: | |||
ga_F: ATCCGTGATGCTGTGCTATG | |||
Gfb(R): CAATCACTGTTGCTCAGTGC | |||
Product size: 510bp | |||
'''Observation''' | |||
• Taster: Taster specific primer pair produced a 911bp band while there were no specific bands with non-taster specific primer pair. | |||
• Non-taster: Non-taster specific primer pair produced a 510bp band while there were no specific bands with taster specific primer pair. | |||
• Blanks: Water sample used instead of the genomic DNA produced only unspecific products, primer dimers probably, with both sets of primers. | |||
'''Conclusion''' | |||
• PTC taster and non-taster can be identified genotypically with PCR using the primer pairs used in this experiment. | |||
'''Gradient PCR''' | |||
Gradient PCR using the specific primer pairs was performed to identify optimal temperature for both taster and non-taster. | |||
[[Image: gradientPCR_14.11.jpg|right|thumb|400px|gradient PCR]] | |||
[[Image: gradientPCRelec_14.11.jpg|right|thumb|400px|electrophoresis]] | |||
'''Observation''' | |||
• All the temperatures applied in this PCR were able to produce specific bands for both taster and non-taster. | |||
• There were also a few unspecific bands with taster DNA at lower temperatures. | |||
• The most prominent bands for both the taster and the non-taster DNA samples were observed at 60.5°C. | |||
'''Conclusion''' | |||
• The taster and non-taster alleles can be separated using the two given primer pairs at the optimal temperature of 60.5°C. | |||
Revision as of 23:49, 25 November 2014
Project name | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html> |
Final separation and gradient PCRPTC taster and non-taster separation Two primer pairs were taken so that the PTC taster and non-taster could be separated.
EP9_F: AGCTATGCCCCCTTTCCTCT Cfb(R): CAATCACTGTTGCTCAGTGG Product size: 911bp
ga_F: ATCCGTGATGCTGTGCTATG Gfb(R): CAATCACTGTTGCTCAGTGC Product size: 510bp
• Taster: Taster specific primer pair produced a 911bp band while there were no specific bands with non-taster specific primer pair. • Non-taster: Non-taster specific primer pair produced a 510bp band while there were no specific bands with taster specific primer pair. • Blanks: Water sample used instead of the genomic DNA produced only unspecific products, primer dimers probably, with both sets of primers.
• PTC taster and non-taster can be identified genotypically with PCR using the primer pairs used in this experiment.
Gradient PCR using the specific primer pairs was performed to identify optimal temperature for both taster and non-taster.
• All the temperatures applied in this PCR were able to produce specific bands for both taster and non-taster. • There were also a few unspecific bands with taster DNA at lower temperatures. • The most prominent bands for both the taster and the non-taster DNA samples were observed at 60.5°C.
• The taster and non-taster alleles can be separated using the two given primer pairs at the optimal temperature of 60.5°C.
|