User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/07/07: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
mNo edit summary
Line 1: Line 1:
{|{{table}} width="800"
|-
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> PHIX174 Cell Free Expression</span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|-
| colspan="2"|
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
{|{{table}} width="800"
{|{{table}} width="800"
|-
|-
Line 41: Line 34:
** ΦX174 template concentration (final) = 0.1 nM  
** ΦX174 template concentration (final) = 0.1 nM  
** Primer concentration (final) = 1 μM primer (each)
** Primer concentration (final) = 1 μM primer (each)
** Sense primer =  
** Sense primer = GTCGACGCATGCATGACTCGCAAGGTTAGTGC
** Antisense primer =  
** Antisense primer = AACATACAATTGGGAGGGTGT
** T<sub>H</sub> = 58 °C
** T<sub>H</sub> = 58 °C
** N cycles = 36
** N cycles = 36
** Amplicon = 300bp (PL-L-PA with ... and ... extensions to the fore and aft)
** Amplicon = SalI-SphI-PL-L-PA-MfeI (282bp, 12bp SalI-SphI upstream primer extension)
** Negative control = -template
** Negative control = -template
      
      

Revision as of 14:29, 7 July 2012

PHIX174 Cell Free Expression <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Characterization B: Expression of PHIX174 promoters fused to UTR1-deGFP.

  • From yesterday's ligation, only a few colonies on the NC background, with even fewer in the backbone + linker ligation.
  • Determined problem. Linker used was "SphI-PA-NcoI," when the design file clearly shows that the linker is "SphI-PA-NheI." So incompatible backbone was used with this linker.
  • Repeated ligation with correct backbone (~4 hr reaction time).
    • 0.5 μL 15nM pBEST-SphI//NheI-deGFP-T500
    • 5 μL 100nM SphI-PA-NheI
    • Ratio = 1:66
    • Negative control = -linker
    • Transformed 2.5 μL ligation product into JM109.

Characterization C: Expression of PHIX174 promoters fused to UTRX-deGFP.

  • From yesterday's ligation, only a few colonies on the NC background, with even fewer in the backbone + linker ligation.
  • Determined problem. Linker used was "SphI-PA-UTRA-NheI," when the design file clearly shows that the linker is "SphI-PA-UTRA-NcoI." So incompatible backbone was used with this linker.
  • Repeated ligation with correct backbone (~4 hr reaction time).
    • 0.5 μL 16nM pBEST-SphI//NcoI-deGFP-T500
    • 5 μL 100nM SphI-PA-UTRA-NcoI
    • Ratio = 1:66
    • Negative control = -linker
    • Transformed 2.5 μL ligation product into JM109.

Hypothesis 2: Gene L is necessary for phage propagation.

  • Since I know whole plasmid PCR works in principle, I need to determine whether or not it is the ΦX174 template or the primers, the only other components of the reactoin, that is the problem.
  • First, I will attack the template, since I have amplified portions of it in the past. Therefore, I performed standard PCR as a positive control to determine whether or not the template is working.
    • ΦX174 template concentration (final) = 0.1 nM
    • Primer concentration (final) = 1 μM primer (each)
    • Sense primer = GTCGACGCATGCATGACTCGCAAGGTTAGTGC
    • Antisense primer = AACATACAATTGGGAGGGTGT
    • TH = 58 °C
    • N cycles = 36
    • Amplicon = SalI-SphI-PL-L-PA-MfeI (282bp, 12bp SalI-SphI upstream primer extension)
    • Negative control = -template



Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Sean_P_Corum/Notebook/PHIX174_Cell_Free/2012/07/07&oldid=612868"