User:Spenser Skates/Notebook/pTKX luciferase biobrick/2008/04/16: Difference between revisions
From OpenWetWare
(Autocreate 2008/04/16 Entry for User:Spenser_Skates/Notebook/pTKX_luciferase_biobrick) |
|||
| Line 5: | Line 5: | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
== | ==Removal of XbaI site by Mutagenesis== | ||
Performed site directed mutagenesis using the following primers for PCR in order to remove the XbaI site. | |||
cattaatgaattgccgaataatctggattttgaaggccataaattg,luxMutPF | |||
caatttatggccttcaaaatccagattattcggcaattcattaatg,luxMutPR | |||
Changed base 2123 from A to G. | |||
Used Phusion mix, applied the following protocol: | |||
[[Knight:Site-directed_mutagenesis/Single_site]] | |||
<!-- ## Do not edit below this line unless you know what you are doing. ## --> | <!-- ## Do not edit below this line unless you know what you are doing. ## --> | ||
|} | |} | ||
Revision as of 05:47, 6 May 2008
 Project name
|
<html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Removal of XbaI site by MutagenesisPerformed site directed mutagenesis using the following primers for PCR in order to remove the XbaI site. cattaatgaattgccgaataatctggattttgaaggccataaattg,luxMutPF caatttatggccttcaaaatccagattattcggcaattcattaatg,luxMutPR Changed base 2123 from A to G. Used Phusion mix, applied the following protocol: Knight:Site-directed_mutagenesis/Single_site | |
