User:Spenser Skates/Notebook/pTKX luciferase biobrick/2008/04/16: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 5: Line 5:
|-
|-
| colspan="2"|
| colspan="2"|
==Removal of XbaI site by Mutagenesis==
==Removal of XbaI site by site-directed mutagenesis==
Performed site directed mutagenesis using the following primers for PCR in order to remove the XbaI site.
Performed site directed mutagenesis using the following primers for PCR in order to remove the XbaI site.
<br><br>
<br><br>

Revision as of 06:48, 6 May 2008

Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Removal of XbaI site by site-directed mutagenesis

Performed site directed mutagenesis using the following primers for PCR in order to remove the XbaI site.

cattaatgaattgccgaataatctggattttgaaggccataaattg,luxMutPF
caatttatggccttcaaaatccagattattcggcaattcattaatg,luxMutPR

Changed base 2123 from A to G.

Used Phusion mix, applied the following protocol:
Knight:Site-directed_mutagenesis/Single_site