User:Stuart McKellar/Notebook/Bird Sex Testing/2013/01/04

From OpenWetWare

< User:Stuart McKellar | Notebook | Bird Sex Testing | 2013 | 01(Difference between revisions)
Jump to: navigation, search
(Autocreate 2013/01/04 Entry for User:Stuart_McKellar/Notebook/Bird_Sex_Testing)
Current revision (19:16, 8 January 2013) (view source)
(Temps and new primers)
(3 intermediate revisions not shown.)
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
==Entry title==
==Reconciling information and thoughts after break==
* Insert content here...
I did some reading and thinking and research during the xmas break. This is the result.
=Housekeeping Genes=
Finally found some housekeeping primers:
18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB)
=Temps and new primers=
P2/P8 primers work best at 60C, confirming my lab work.
(from )
also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.
NP primer:
MP primer:
Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.
Mushy primers:
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->

Current revision

Project name Main project page
Previous entry      Next entry

Reconciling information and thoughts after break

I did some reading and thinking and research during the xmas break. This is the result.

Housekeeping Genes

Finally found some housekeeping primers: 18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB) 18S-R1309 18S a AGTCTCGTTCGTTATCGGAATT This study (SVB)


Temps and new primers

P2/P8 primers work best at 60C, confirming my lab work. (from )

also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.



Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.

Mushy primers: ITS1 5'-TCCGTAGGTGAACCTGCGG-3' forward all ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all


Personal tools