User:Stuart McKellar/Notebook/Bird Sex Testing/2013/01/04
From OpenWetWare
(→Temps and new primers) |
Current revision (19:16, 8 January 2013) (view source) (→Temps and new primers) |
||
| Line 23: | Line 23: | ||
also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers. | also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers. | ||
| + | |||
| + | NP primer: | ||
| + | 5’-GAG AAA CTG TGC AAAACA G-3’ | ||
| + | |||
| + | MP primer: | ||
| + | 5’-AGT CAC TAT CAG ATC CGG AA-3’ | ||
Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead. | Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead. | ||
Current revision
Main project page Previous entry Next entry
| |
Reconciling information and thoughts after breakI did some reading and thinking and research during the xmas break. This is the result. Housekeeping GenesFinally found some housekeeping primers: 18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB) 18S-R1309 18S a AGTCTCGTTCGTTATCGGAATT This study (SVB) (from http://wwwnc.cdc.gov/eid/article/11/5/05-0211-t1.htm) Temps and new primersP2/P8 primers work best at 60C, confirming my lab work. (from http://www.academia.edu/1460726/Sex_Identification_of_Some_Pet_Birds_by_Polymerase_Chain_Reaction-Based_Methods ) also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers. NP primer: 5’-GAG AAA CTG TGC AAAACA G-3’ MP primer: 5’-AGT CAC TAT CAG ATC CGG AA-3’ Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.
EDIT THESE PAGES TO SEE NICE FORMATTING | |



