User:Student 57/Notebook/Biology 210 at AU: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(18 intermediate revisions by 2 users not shown)
Line 1: Line 1:
'''Protists and Algae'''
'''Zebrafish'''


January 28, 2016
March 10, 2016


''Purpose'' <br>
''Purpose''<br>  
To identify protist and algae samples from the Hay Infusion sample from Transect Four. Describe protist samples and document where in the Hay Infusion ecosystem they came from.  
The purpose of this experiment was to observe the impact of movement disruption on the embryological development of zebrafish. It was hypothesized that the constant motion that the experimental group was exposed to would stunt their growth in comparison to the control group.  


''Materials and Methods'' <br>
''Materials and Methods''<br>
The experiment began with 48 total zebrafish, 24 in a control group and 24 in an experimental group. The experimental group was exposed to 200 RPM on a Hybrid Capture System machine 24 hours a day for the 14 day duration of the experiment. The zebrafish were kept in individual petri dishes with deerpark water with anti-fungal methylene blue treatment. The zebrafish were observed every few days to determine the impact of motion on development.


The hay infusion culture was created in a jar by adding 10 grams of soil and vegetation from transect four, 500 milliliters of deerpark water, and .1 gram of dried milk. This was mixed for ten seconds and left in the lab at room temperature with the top off for one week. Upon observation the hay infusion smelled a bit of rotting eggs and standing water.The appearance was dark with dirt settled to the bottom.
''Data and Observations''<br>


After a week, samples were taken from two different locations in the Hay Infusion ecosystem. The first niche was shallow and near the surface of the Hay Infusion jar. On the surface there was a thin white film on top of the water, and the sample was pulled just below this surface. The second niche was deeper and close to the flower petal that fell to the bottom of the jar.  
[[Image:WasonZebraEmbry.png]]


''Data and Observations'' <br>
Figure 1. Stages of embryonic development of zebrafish.


[[Image:AlgaeProtistTable.png]]
[[Image:WasonWells1.png]]<br>
Figure 2. Embryonic growth of the control group.


Difflugia, Blepharisma, and Euglena were found in niche one near the surface of the Hay Infusion. Stentor, Volvox, and Arcella were found in the second niche nearer to the plant life in the jar. The organisms nearer to the plant may not be able to photosynthesize themselves, and rely on plants for their energy source.  
[[Image:WasonWells2.png]] <br>
Figure 3. Embryonic growth of experimental group.  


[[Image:Feb41.jpg]]
[[Image:Embryo2.png]]<br>
Figure 4. Control group embryo.


[[Image:Feb42.jpg]]
[[Image:Embryo1.png]]<br>
Figure 5. Experimental group embryo.


[[Image:Feb43.jpg]]
[[Image:Wason_Control.png]]<br>
Table 1. Zebrafish control results.


[[Image:Feb44.jpg]]
[[Image:Wason_Experimental.png]] <br>
Table 2. Zebrafish experimental results.


[[Image:Feb45.jpg]]
''Conclusions and Future Directions''<br>
By the end of the experiment, all of the zebrafish had died. The group that was exposed to consistent motion died earlier than the control group. As seen in figures 2-5, the embryonic growth of the experimental group was visibly quicker than that of the control group. The differences in movement in the experimental and control groups were not very different throughout the duration of the experiment. Continued study of disrupted motion would help to discover more about its impact on vertebrates.  


[[Image:Feb46.jpg]]
LW


Volvox meets all the life of needs requirements as described in "Biological Science."
'''Vertebrates'''
*Energy: Volvox procure energy by photosynthesizing.
*Cells: Each Volvox colony is made of a number of cells.
*Information: Genetic information stored in nuclei.
*Replication: Asexual reproduction.
*Evolution: Ancestors of Volvox became colonies from single cells.


March 3, 2016


''Purpose''<br>The purpose of this experiment was to consider the vertebrates that inhabit Transect Four and create a food web depicting the tropic levels of the overall ecosystem.


''Conclusions and Future Directions'' <br>  
''Materials and Methods''<br>
When taking the samples from two separate niches it was hypothesized that different protists and algae would favor certain environments within this ecosystem. Photosynthesizing organisms tended to prefer the niche nearest to the top of the jar, while algae were found nearest to plant matter. Though this is a small ecosystem, it would be expected that similar patterns happen in nature on  a much larger scale.  
Using data from previous experiments, the vertebrate populations of Transect Four were extrapolated. Using the textbook, the vertebrates were classified into species and abiotic and biotic factors that benefitted each were identified.  


If the hay infusion were allowed to grow for another two months I would expect more distinct patterns of behavior in terms of where they would be found in the jar among protists and algae. If the jar were kept in the lab, I would expect that photosynthesizing organisms would struggle more than if they were in the pond in transect four.
''Observations and Data''<br>


[[Image:Wason31.png]]<br>
Table 1. Identified vertebrates.


To prepare for next week, a serial dilution of agar plates was done in preparation for the "MIcrobiology and Identifying Bacteria" Lab,<br>
[[Image:WasonFoodWeb.png]]
Figure 1. Food Web from Transect Four.
[[Image:Serial_WasonDilution.jpg]]
 
The food web depicts a ''community'', where each of these species interacts with one another in a particular area, which would be Transect Four. The species that were found in Transect Four demonstrate the ''carrying capacity'' of the environment, in that only a certain number of a certain species can inhabit this area. The different ''trophic levels'' of each of the species show where they would be on the food chain in this ecosystem.


LW


'''Transect Four
''Conclusions and Future Directions''<br>
January 14, 2016'''
The vertebrates in range four are assumed to have a number of different species. Due to the unique pond ecosystem, it was expected that all of the organisms present would interact with the water and benefit from this in the environment. The relationships among the organisms present in Transect Four, depicted in Figure 1, show how they organisms interact in varying trophic levels. The energy that passes through the ecosystem relies on every organism, from the eukaryotic bacteria to the vertebrate mammalia. The continued study of transects on the American University campus will continue to build the knowledge of the ecosystem as a whole.


Location: This transect is located near McCabe on the southern end of American University's campus.
LW


The 20 by 20 foot transect is located on the edge of a courtyard surrounded by buildings. North of the pond, there are two benches on the border of this transect. The southern edge of the transect is closest to a building where outdoor lighting shines into the area. There are two larger trees in the area, as well as smaller bushes and grass. The pond is covered by a net that is constructed with bamboo sticks. The pond itself is man made and constructed of large rocks. To the north of the pond, there is a courtyard with heavy foot traffic.
'''16S Sequence Analysis'''


Topography: There is a pond at the center of the transect. The pond is bordered with rocks. There are two large trees as well as a few smaller trees and bushes.
February 24, 2016


Biotic components: Pond, trees, bushes, grass, insects.  
''Purpose:'' <br>
The purpose of this experiment was to determine the species of soil bacteria collected from Transect Four using a nucleotide sequence for the 16S rRNA gene through the polymerase chain reaction technique (PCR).  


Abiotic components: Rocks, statues, bamboo covering the pond, net covering the pond.  
''Materials and Methods:'' <br>
A sample of bacteria collected from Transect 4 was amplified using PCR and sent to a lab for sequencing. The sequence of nucleotides was entered into BLAST to determine the species of bacteria.  


[[Image:Transect Four Wason Diagram.jpg]]
''Observations and Data:'' <br>


A Blast was done using the following nucleotide sequence for Transect Four borrowed from Ricardo Rodriguez:


LW
CTCCTNNNACGNGTCACCGNCTTCAGGTACCCCATNNNNNCCATGGCTTGACGGGC GGTGTGTACAAGGCCCGGGAACGTATTCACCGCGCCATGGCTGATGCGCGATTACTAGCGATTCCAGCTTCATAGAGTCG AGTTGCAGACTCCAATCCGAACTGAGACCAGCTTTCGAGATTCGCATCCAGTCACCTGGTAGCTGCCCTCTGTACTGGCC ATTGTATTACGTGTGTGGCCCAAGGCGTAAGGGCCGTGATGATTTGACGTCATCCCCACCTTCCTCTCTACTTGCGTAGG CAGTCTCACTAGAGTCCCCAACTGAATGATGGCAACTAGTGACAGGGGTTGCGCTCGTTGCAGGACTTAACCTAACACCT CACGGCACGAGCTGACGACAACCATGCAGCACCTTGAAAAATGTCCGAAGAAAAGTCTATTTCTAA

Latest revision as of 10:01, 8 March 2016

Zebrafish

March 10, 2016

Purpose
The purpose of this experiment was to observe the impact of movement disruption on the embryological development of zebrafish. It was hypothesized that the constant motion that the experimental group was exposed to would stunt their growth in comparison to the control group.

Materials and Methods
The experiment began with 48 total zebrafish, 24 in a control group and 24 in an experimental group. The experimental group was exposed to 200 RPM on a Hybrid Capture System machine 24 hours a day for the 14 day duration of the experiment. The zebrafish were kept in individual petri dishes with deerpark water with anti-fungal methylene blue treatment. The zebrafish were observed every few days to determine the impact of motion on development.

Data and Observations

Figure 1. Stages of embryonic development of zebrafish.


Figure 2. Embryonic growth of the control group.


Figure 3. Embryonic growth of experimental group.


Figure 4. Control group embryo.


Figure 5. Experimental group embryo.


Table 1. Zebrafish control results.


Table 2. Zebrafish experimental results.

Conclusions and Future Directions
By the end of the experiment, all of the zebrafish had died. The group that was exposed to consistent motion died earlier than the control group. As seen in figures 2-5, the embryonic growth of the experimental group was visibly quicker than that of the control group. The differences in movement in the experimental and control groups were not very different throughout the duration of the experiment. Continued study of disrupted motion would help to discover more about its impact on vertebrates.

LW

Vertebrates

March 3, 2016

Purpose
The purpose of this experiment was to consider the vertebrates that inhabit Transect Four and create a food web depicting the tropic levels of the overall ecosystem.

Materials and Methods
Using data from previous experiments, the vertebrate populations of Transect Four were extrapolated. Using the textbook, the vertebrates were classified into species and abiotic and biotic factors that benefitted each were identified.

Observations and Data


Table 1. Identified vertebrates.

Figure 1. Food Web from Transect Four.

The food web depicts a community, where each of these species interacts with one another in a particular area, which would be Transect Four. The species that were found in Transect Four demonstrate the carrying capacity of the environment, in that only a certain number of a certain species can inhabit this area. The different trophic levels of each of the species show where they would be on the food chain in this ecosystem.


Conclusions and Future Directions
The vertebrates in range four are assumed to have a number of different species. Due to the unique pond ecosystem, it was expected that all of the organisms present would interact with the water and benefit from this in the environment. The relationships among the organisms present in Transect Four, depicted in Figure 1, show how they organisms interact in varying trophic levels. The energy that passes through the ecosystem relies on every organism, from the eukaryotic bacteria to the vertebrate mammalia. The continued study of transects on the American University campus will continue to build the knowledge of the ecosystem as a whole.

LW

16S Sequence Analysis

February 24, 2016

Purpose:
The purpose of this experiment was to determine the species of soil bacteria collected from Transect Four using a nucleotide sequence for the 16S rRNA gene through the polymerase chain reaction technique (PCR).

Materials and Methods:
A sample of bacteria collected from Transect 4 was amplified using PCR and sent to a lab for sequencing. The sequence of nucleotides was entered into BLAST to determine the species of bacteria.

Observations and Data:

A Blast was done using the following nucleotide sequence for Transect Four borrowed from Ricardo Rodriguez:

CTCCTNNNACGNGTCACCGNCTTCAGGTACCCCATNNNNNCCATGGCTTGACGGGC GGTGTGTACAAGGCCCGGGAACGTATTCACCGCGCCATGGCTGATGCGCGATTACTAGCGATTCCAGCTTCATAGAGTCG AGTTGCAGACTCCAATCCGAACTGAGACCAGCTTTCGAGATTCGCATCCAGTCACCTGGTAGCTGCCCTCTGTACTGGCC ATTGTATTACGTGTGTGGCCCAAGGCGTAAGGGCCGTGATGATTTGACGTCATCCCCACCTTCCTCTCTACTTGCGTAGG CAGTCTCACTAGAGTCCCCAACTGAATGATGGCAACTAGTGACAGGGGTTGCGCTCGTTGCAGGACTTAACCTAACACCT CACGGCACGAGCTGACGACAACCATGCAGCACCTTGAAAAATGTCCGAAGAAAAGTCTATTTCTAA

Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Student_57/Notebook/Biology_210_at_AU&oldid=933892"