User:Torsten Waldminghaus/Notebook/Methylation array: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(→PCR) |
|||
Line 154: | Line 154: | ||
#Purify PCR product and measure at Nanodrop | #Purify PCR product and measure at Nanodrop | ||
===Labeling for hybridisation to microarray=== | |||
*Adjust DNA in 20μl volume to a concentration of 15ng/μl. | *Adjust DNA in 20μl volume to a concentration of 15ng/μl. | ||
*Note that one allways needs one test sample that will be labeld with one CyDye and a control labeld with another. As control one could use chromosomal DNA which was not digested with Dpn | *Note that one allways needs one test sample that will be labeld with one CyDye and a control labeld with another. As control one could use chromosomal DNA which was not digested with Dpn | ||
Line 177: | Line 177: | ||
*Mix by flicking the tube followed by a brief (<10 secs) spin a microfuge. | *Mix by flicking the tube followed by a brief (<10 secs) spin a microfuge. | ||
*Incubate at 37 °C for 5 hours (the time of incubation determins the degree of amplification so you could vary it if you want or need to). | *Incubate at 37 °C for 5 hours (the time of incubation determins the degree of amplification so you could vary it if you want or need to). | ||
*Use QIAquick PCR purification kit for cleaning up the labeld DNA. Elute DNA with | *Use QIAquick PCR purification kit for cleaning up the labeld DNA. Elute DNA with 25μL of elution buffer from the column. The colour of the column after the wash step gives a first impression of the degree of labeling. | ||
*Measure the CyDye and DNA concentration of the samples at Nanodrop | *Measure the CyDye and DNA concentration of the samples at Nanodrop. | ||
===Hybridisation to microarray=== | |||
*The following protocol is thought for hybridisation of OGT arrays with Agilent SureHyb equipment | *The following protocol is thought for hybridisation of OGT arrays with Agilent SureHyb equipment. | ||
*Remove slide box from packaging and store slides until use in a dehumidified chamber. The slides should be stored in a light tight box. | *Remove slide box from packaging and store slides until use in a dehumidified chamber. The slides should be stored in a light tight box. | ||
*When ready for use, remove slides from box. Wear clean powder free gloves at all times when handling the microarrays. Handling should be carried out in a low dust laboratory. Return unused slides to dehumidified chamber. | *When ready for use, remove slides from box. Wear clean powder free gloves at all times when handling the microarrays. Handling should be carried out in a low dust laboratory. Return unused slides to dehumidified chamber. | ||
*The arrays are printed on the same side of the slide to the label 'Agilent'. | *The arrays are printed on the same side of the slide to the label 'Agilent'. | ||
*Hybridisations are carried out in a | *Hybridisations are carried out in a 45μl volume per array. | ||
*The volume of CyDye labeld DNA must be reduced in a SpeedVac and be adjusted to | *The volume of CyDye labeld DNA must be reduced in a SpeedVac and be adjusted to 12.5 μL. | ||
*Prepare the hybridisation buffer by pipetting the following into a tube. CARE Formamide is toxic. | *Prepare the hybridisation buffer by pipetting the following into a tube. CARE Formamide is toxic. | ||
{| border="3" | {| border="3" | ||
! Component !! Volume for | ! Component !! Volume for 62.5μL hybridisation (μL)!! Volume for one slide with eight arrays | ||
|- | |- | ||
|12xMES || | |12xMES ||5 ||50 | ||
|- | |- | ||
|5M Sodium chloride || | |5M Sodium chloride ||12||120 | ||
|- | |- | ||
|Formamide || | |Formamide ||12||120 | ||
|- | |- | ||
|0.5M EDTA ||5||25 | |0.5M EDTA ||2.5||25 | ||
|- | |- | ||
|10% Triton X100 || | |10% Triton X100 ||6||60 | ||
|} | |} | ||
*The given volumes in the first column are for one hybridisation. If you have more than one you should do a master mix (second column) and use | *The given volumes in the first column are for one hybridisation. If you have more than one you should do a master mix (second column) and use 37.5μL in the following step. | ||
*In a different tube join the differentialy labeled test and control DNA as follows: | *In a different tube join the differentialy labeled test and control DNA as follows: | ||
{| border="3" | {| border="3" | ||
! Component !! Volume for | ! Component !! Volume for 62.5μL hybridisation (μL) | ||
|- | |- | ||
|Cy3 labeld DNA|| | |Cy3 labeld DNA||12.5 | ||
|- | |- | ||
|Cy5 labeld DNA|| | |Cy5 labeld DNA||12.5 | ||
|- | |- | ||
|} | |} | ||
Line 214: | Line 214: | ||
*Spin down and add sample mix in tube with hybridisation buffer (see above). | *Spin down and add sample mix in tube with hybridisation buffer (see above). | ||
*Place an Agilent SureHyb GASKET slide into an Agilent CHAMBER base. | *Place an Agilent SureHyb GASKET slide into an Agilent CHAMBER base. | ||
*Pipette | *Pipette 45μl of hybridisation mix onto the GASKET slide. | ||
*Place an OGT array slide onto the GASKET slide with the array side down (with 'Agilent' label) and in contact with the hybridisation mix. | *Place an OGT array slide onto the GASKET slide with the array side down (with 'Agilent' label) and in contact with the hybridisation mix. | ||
*Place the CLAMP ASSEMBLY on the slide and tighten the thumbscrew. | *Place the CLAMP ASSEMBLY on the slide and tighten the thumbscrew. | ||
Line 250: | Line 250: | ||
*A .txt file should be generated. When the .txt file is opened using Microsoft Excel, a spreadsheet should open that will contain one column with the genomic location of the probe on the array. There will be another column with the Green and Red signals (gProcessedSignal and rProcessedSignal). | *A .txt file should be generated. When the .txt file is opened using Microsoft Excel, a spreadsheet should open that will contain one column with the genomic location of the probe on the array. There will be another column with the Green and Red signals (gProcessedSignal and rProcessedSignal). | ||
*One could than for example draw a graph of the genomic location on the X axis versus the ratio of the two dye signals (test/control). | *One could than for example draw a graph of the genomic location on the X axis versus the ratio of the two dye signals (test/control). | ||
==References== | ==References== |
Latest revision as of 03:23, 23 March 2010
Idea
- Analyse the methylation of GATC sites genomewide in E. coli.
Notes
- Løbner-Olesen et al, 2003 [1] used a aroK17::cat strain to have more hemimethylation in the cell, since a polar effect on dam leads to a reduced Dam content in the cell (only 30% of wt [2]). Could be used as control and for interesting analysis.
- methylation in different strains could be interesting:
- dam-overproduction
- seqA deletion, over-production, under-production
- synchronized cells
- does introduction of a GATC cluster alter methylation of surrounding sites?
- what about GATC sites in datA? sequestration?
- one could compare methylation in protein coding regions with intergenic regions and RNA coding.
- one could analyse effect of distance to oriC and density of GATCs
- REN to cut the chrom. DNA in the first step could be MseI which was used before [3]. It cuts TTAA and can be heat inactivated at 65 °C for 20 min (http://www.neb.com/nebecomm/products/productR0525.asp).
- As independent method and first step one could analyse cutting by methylation sensitive REN with qPCR
- on whole chromosome
- clusters and isolated GATCs
- coding regions and intergenic regions
Possible restriction enzymes that are Dam methylation sensitive:
Enzyme | Site | Notes | Link |
---|---|---|---|
HphI | GGTGA | No star activity; reaction at 37°C; heatinactivation at 20 min 65°C | http://www.fermentas.com/catalog/re/hphi.htm |
MboII | GAAGA | Star activity; reaction at 37°C; heatinactivation at 20 min 65°C | http://www.fermentas.com/catalog/re/mboii.htm |
TaqI | TCGA | No star activity; reaction at 65 °C; no heatinactivation after 20 min 80°C | http://www.fermentas.com/catalog/re/taqi.htm |
- HphI seems to be a good choice since it can be heatinactivated and has no star activity (does not cleave unspecific when DNA is overdigested).
- In unsynchronized cultures the detection of hemimethylation will be difficult. If every GATC is hemimethylated for about 1 min and replication of the chromosome takes about 50 min, than about 2% of a specific GATC will be in a hemimethylated state giving only 1% cut with an overlapping enzyme.
- One possibility to make the restriction outcome higher could be to use sites like ggtgatcacc that have two HphI restriction sites overlapping one GATC. This should give a doubling in cutting at that site compared to only one HphI site. However, a 10bp long inverted repeat might not give a representative result for GATC methylation because some whatever protein could bind there. The E. coli K12 genome contains 33 ggtgatcacc sites:
Start End Pattern_name Mismatch Sequence 118460 118469 pattern1 . GGTGATCACC 143911 143920 pattern1 . GGTGATCACC 210581 210590 pattern1 . GGTGATCACC 282472 282481 pattern1 . GGTGATCACC 330621 330630 pattern1 . GGTGATCACC 379605 379614 pattern1 . GGTGATCACC 405197 405206 pattern1 . GGTGATCACC 599247 599256 pattern1 . GGTGATCACC 636380 636389 pattern1 . GGTGATCACC 681039 681048 pattern1 . GGTGATCACC 685084 685093 pattern1 . GGTGATCACC 712647 712656 pattern1 . GGTGATCACC 826095 826104 pattern1 . GGTGATCACC 834158 834167 pattern1 . GGTGATCACC 854836 854845 pattern1 . GGTGATCACC 900826 900835 pattern1 . GGTGATCACC 1065260 1065269 pattern1 . GGTGATCACC 1107328 1107337 pattern1 . GGTGATCACC 1363023 1363032 pattern1 . GGTGATCACC 2152717 2152726 pattern1 . GGTGATCACC 2358426 2358435 pattern1 . GGTGATCACC 2540379 2540388 pattern1 . GGTGATCACC 2953039 2953048 pattern1 . GGTGATCACC 3010031 3010040 pattern1 . GGTGATCACC 3042067 3042076 pattern1 . GGTGATCACC 3268923 3268932 pattern1 . GGTGATCACC 3528134 3528143 pattern1 . GGTGATCACC 3540084 3540093 pattern1 . GGTGATCACC 3607305 3607314 pattern1 . GGTGATCACC 3858080 3858089 pattern1 . GGTGATCACC 4238710 4238719 pattern1 . GGTGATCACC 4292770 4292779 pattern1 . GGTGATCACC 4463247 4463256 pattern1 . GGTGATCACC
Name (localisation of HphI site) | feature in this region | MseI sites | GATCs | Sequence | Size of MseI fragment | Oligos for qPCR | |
---|---|---|---|---|---|---|---|
761873 | sucB CDS | 761873_P CGAATCCGTGGGCTTCCTGG 761873_fw GAGATCCTGCCGATGATGTA 761873_rv TTCCAGCAACTCTTTGATCG |
- One other possibility to check the hemimethylation in general is to isolate chrom. DNA and than methylate it with radioactive SAM. The amount of incorparated radioactivity should be proportianal to the hemi or unmethylated DNA. As control one could use the same DNA that was incubated with Dam and non radioactive SAM before. Defined substrates as for example a plasmid from dam- strain could help to normalize the found radioactivity and calculate how many GATCs were hemimethylated.
Protocol REN-qPCR
Isolate DNA from MG1655
- grow cells
- take 2x 10ml samples at OD 0.15 and transfer directly to 10 ml TE with 3% SDS at 65 °C (7ml TE + 3ml 10% SDS)
- leave at 65 °C for 5 min
- add 10 ml Isopropanol and store at -80 °C for 30 min
- centrifuge hith speed for 20 min
- wash in 70% ethanol and transfer to 2 ml reaction tubes
- resuspend in 200 μL A. dest
- add 1 μL RNase A (27.5 mg/ml) and incubate 30 min at 65 °C
- add 10 μL proteinase K (20 mg/ml) 1h at 50 °C (endconcentration = 1 mg/ml).
- extract with phenol/chlorophorm
- preciptitate with ehanol and Na-acetate
- resuspend in 50 μL A. dest and meassure at Nanodrop
Protocol Methylation Array
DNA isolation
MseI Restriction
- Digest 500ng chrom. DNA with 10U of MseI in 10μL volume for 3h at 37°C.
- Heat inactivate for 20 min at 65°C
Linker Ligation
- Annealing of oligos MseILong (5' AGTGGGATTCCGCATGCTAGT 3') and MseIShort (5' TAACTAGCATCG 3')[4]:
- Mix 1μL of 100μM (=100pmol/μL) stocks of both primers with 6μL H2O in PCR tube
- Run program starting with 3 min 95°C and than cooling down from 70°C to 15°C with 1°C per 1 minute.
- At 15°C add 10μL MseI cut DNA, 2μL Ligase Buffer and 1μL Ligase
- Ligate over night at 15°C
Dpn digest
- 5μL NEB buffer 4
- 10μL DNA (~250 ng)
- 1μL DpnI (20 U)
- 34μL dH2O
- 5μL NEB DpnII-buffer
- 10μL DNA (~250 ng)
- 1μL DpnII (20 U)
- 34μL dH2O
- Control DNA with 1µl water instead of the enzyme
- Incubate at 37°C for 1h
- Inactivate at 80°C for 20 min
PCR
- for each Dpn digest run one PCR (to amplify the non cut DNA):
- 5μL DNA (~25ng)
- 2.5μL dNTP mix (4mM each)
- 2.5μL primer MseIlong (10μM)
- 5μL Taq buffer
- 1μL Taq
- 29μL dH2O
- Program:
- 95°C 30sec
- 62°C 30sec
- 72°C 90sec
- Go to 1 for 19 more cycles
- 72°C 10min
- 4°C∞
- Purify PCR product and measure at Nanodrop
Labeling for hybridisation to microarray
- Adjust DNA in 20μl volume to a concentration of 15ng/μl.
- Note that one allways needs one test sample that will be labeld with one CyDye and a control labeld with another. As control one could use chromosomal DNA which was not digested with Dpn
- add 20μL 2.5x Random primer (BioPrime kit) to each 20μl DNA sample.
- Mix by flicking the tubes and spinning for 15 seconds in a microfuge.
- Denature in a heat block at 94 degrees centigrade for 3 minutes.
- Microfuge for 15 seconds.
- Add the following to the tubes.
Test Sample 1(μl) | Control Sample 2(μl) | |
---|---|---|
dNTP mix (2mM dATP, 2mM dGTP, 2mM dTTP, 0.5mM dCTP) | 5 | 5 |
Cy3-dCTP (1mM) | 3.75 | - |
Cy5-dCTP (1mM) | - | 3.75 |
Klenow (BioPrime kit) | 1 | 1 |
- Mix by flicking the tube followed by a brief (<10 secs) spin a microfuge.
- Incubate at 37 °C for 5 hours (the time of incubation determins the degree of amplification so you could vary it if you want or need to).
- Use QIAquick PCR purification kit for cleaning up the labeld DNA. Elute DNA with 25μL of elution buffer from the column. The colour of the column after the wash step gives a first impression of the degree of labeling.
- Measure the CyDye and DNA concentration of the samples at Nanodrop.
Hybridisation to microarray
- The following protocol is thought for hybridisation of OGT arrays with Agilent SureHyb equipment.
- Remove slide box from packaging and store slides until use in a dehumidified chamber. The slides should be stored in a light tight box.
- When ready for use, remove slides from box. Wear clean powder free gloves at all times when handling the microarrays. Handling should be carried out in a low dust laboratory. Return unused slides to dehumidified chamber.
- The arrays are printed on the same side of the slide to the label 'Agilent'.
- Hybridisations are carried out in a 45μl volume per array.
- The volume of CyDye labeld DNA must be reduced in a SpeedVac and be adjusted to 12.5 μL.
- Prepare the hybridisation buffer by pipetting the following into a tube. CARE Formamide is toxic.
Component | Volume for 62.5μL hybridisation (μL) | Volume for one slide with eight arrays |
---|---|---|
12xMES | 5 | 50 |
5M Sodium chloride | 12 | 120 |
Formamide | 12 | 120 |
0.5M EDTA | 2.5 | 25 |
10% Triton X100 | 6 | 60 |
- The given volumes in the first column are for one hybridisation. If you have more than one you should do a master mix (second column) and use 37.5μL in the following step.
- In a different tube join the differentialy labeled test and control DNA as follows:
Component | Volume for 62.5μL hybridisation (μL) |
---|---|
Cy3 labeld DNA | 12.5 |
Cy5 labeld DNA | 12.5 |
- denature at 94°C for 3 min
- Spin down and add sample mix in tube with hybridisation buffer (see above).
- Place an Agilent SureHyb GASKET slide into an Agilent CHAMBER base.
- Pipette 45μl of hybridisation mix onto the GASKET slide.
- Place an OGT array slide onto the GASKET slide with the array side down (with 'Agilent' label) and in contact with the hybridisation mix.
- Place the CLAMP ASSEMBLY on the slide and tighten the thumbscrew.
- Some bubbles should form. These bubbles should be moving. If they are not, tap the chamber on the bench.
- Hybridise at 55°C for 2 nights and one day (about 36 hours) in a light tight container, ideally in a hybridisation oven with a rotisserie. Fit the slides vertically and rotate the chambers at a speed at 4 rpm (setting 10 for Agilent hybridisation oven).
Washing and scanning of microarray
- Note: Gloves should be changed after each wash step to not transfer CyDye.
- Prepare the Wash solutions as follows
- Wash 1 (1 litre)
- 20x SSPE 300ml
- 10% N-Lauroylsarcosine 0.5ml
- Water 700ml
Store at room temperature.
- Wash 2 (1 litre)
- 20x SSPE 3ml
- PEG200 1.8ml
- Water 995ml
- Store at room temperature.
- Place 50ml of Wash 1 in a 50ml sterile tube.
- Place 50ml of Wash 2 in a separate 50ml sterile tube.
- Wearing gloves remove the slide from the hybridisation chamber with the GASKET slide still attached. CARE the hybridisation buffer contains formamide.
- Place in a bath of Wash 1 and gently prise the GASKET slide from the OGT microarray under the surface of the Wash 1 buffer (use fingernails at the corners of the arrays).
- Without the microarray drying out place the microarray into the 50ml tube with the Wash 1 buffer.
- Rotate the tube on a rotary mixer at room temperature for 5 minutes.
- Using clean forceps and without the microarray drying out, place the microarray into the 50ml tube with the Wash 2 buffer.
- Rotate the tube on a rotary mixer at room temperature for exactly 5 minutes.
- Using clean forceps remove the microarray and blow dry with dry nitrogen.
- Insert the slide into the scanner and scan according the manufacturer’s instruction booklet. For Agilent scanner insert the slide into the Agilent slide holder. The array slide should be placed into the slide holder with the array side facing up. The 'Agilent' label should also be facing up. The non-labeled edge should be placed into the slide holder first. The slide should be scanned with the green laser (~532nm) and the red laser (~633nm).
Feature extraction with Agilent feature extraction software
- An XML file is supplied from OGT on the CDc to enable the data to be extracted using Agilent’s Feature extraction software. Please refer to the Agilent Feature extraction software documentation for full details.
- Carry out Feature extraction as recommended by the software provider
- A .txt file should be generated. When the .txt file is opened using Microsoft Excel, a spreadsheet should open that will contain one column with the genomic location of the probe on the array. There will be another column with the Green and Red signals (gProcessedSignal and rProcessedSignal).
- One could than for example draw a graph of the genomic location on the X axis versus the ratio of the two dye signals (test/control).
References
- Løbner-Olesen A, Marinus MG, and Hansen FG. Role of SeqA and Dam in Escherichia coli gene expression: a global/microarray analysis. Proc Natl Acad Sci U S A. 2003 Apr 15;100(8):4672-7. DOI:10.1073/pnas.0538053100 |
- Løbner-Olesen A, Boye E, and Marinus MG. Expression of the Escherichia coli dam gene. Mol Microbiol. 1992 Jul;6(13):1841-51. DOI:10.1111/j.1365-2958.1992.tb01356.x |
- Pfister S, Schlaeger C, Mendrzyk F, Wittmann A, Benner A, Kulozik A, Scheurlen W, Radlwimmer B, and Lichter P. Array-based profiling of reference-independent methylation status (aPRIMES) identifies frequent promoter methylation and consecutive downregulation of ZIC2 in pediatric medulloblastoma. Nucleic Acids Res. 2007;35(7):e51. DOI:10.1093/nar/gkm094 |
- Watson SK, deLeeuw RJ, Ishkanian AS, Malloff CA, and Lam WL. Methods for high throughput validation of amplified fragment pools of BAC DNA for constructing high resolution CGH arrays. BMC Genomics. 2004 Jan 14;5(1):6. DOI:10.1186/1471-2164-5-6 |
- Braun RE and Wright A. DNA methylation differentially enhances the expression of one of the two E. coli dnaA promoters in vivo and in vitro. Mol Gen Genet. 1986 Feb;202(2):246-50. DOI:10.1007/BF00331644 |
- Kücherer C, Lother H, Kölling R, Schauzu MA, and Messer W. Regulation of transcription of the chromosomal dnaA gene of Escherichia coli. Mol Gen Genet. 1986 Oct;205(1):115-21. DOI:10.1007/BF02428040 |
- Campbell JL and Kleckner N. E. coli oriC and the dnaA gene promoter are sequestered from dam methyltransferase following the passage of the chromosomal replication fork. Cell. 1990 Sep 7;62(5):967-79. DOI:10.1016/0092-8674(90)90271-f |
- Riber L, Olsson JA, Jensen RB, Skovgaard O, Dasgupta S, Marinus MG, and Løbner-Olesen A. Hda-mediated inactivation of the DnaA protein and dnaA gene autoregulation act in concert to ensure homeostatic maintenance of the Escherichia coli chromosome. Genes Dev. 2006 Aug 1;20(15):2121-34. DOI:10.1101/gad.379506 |
- Bart A, van Passel MW, van Amsterdam K, and van der Ende A. Direct detection of methylation in genomic DNA. Nucleic Acids Res. 2005 Aug 9;33(14):e124. DOI:10.1093/nar/gni121 |
- Rao BS and Buckler-White A. Direct visualization of site-specific and strand-specific DNA methylation patterns in automated DNA sequencing data. Nucleic Acids Res. 1998 May 15;26(10):2505-7. DOI:10.1093/nar/26.10.2505 |