User:Torsten Waldminghaus/Notebook/Methylation array
From OpenWetWare
Jump to navigationJump to search
Idea
- Analyse the methylation of GATC sites genomewide in E. coli.
Notes
- Løbner-Olesen et al, 2003 [1] used a aroK17::cat strain to have more hemimethylation in the cell, since a polar effect on dam leads to a reduced Dam content in the cell (only 30% of wt [2]). Could be used as control and for interesting analysis.
- methylation in different strains could be interesting:
- dam-overproduction
- seqA deletion, over-production, under-production
- synchronized cells
- does introduction of a GATC cluster alter methylation of surrounding sites?
- what about GATC sites in datA? sequestration?
- one could compare methylation in protein coding regions with intergenic regions and RNA coding.
- one could analyse effect of distance to oriC and density of GATCs
- REN to cut the chrom. DNA in the first step could be MseI which was used before [3]. It cuts TTAA and can be heat inactivated at 65 °C for 20 min (http://www.neb.com/nebecomm/products/productR0525.asp).
- As independent method and first step one could analyse cutting by methylation sensitive REN with qPCR
- on whole chromosome
- clusters and isolated GATCs
- coding regions and intergenic regions
Possible restriction enzymes that are Dam methylation sensitive:
Enzyme | Site | Notes | Link |
---|---|---|---|
HphI | GGTGA | No star activity; reaction at 37°C; heatinactivation at 20 min 65°C | http://www.fermentas.com/catalog/re/hphi.htm |
MboII | GAAGA | Star activity; reaction at 37°C; heatinactivation at 20 min 65°C | http://www.fermentas.com/catalog/re/mboii.htm |
TaqI | TCGA | No star activity; reaction at 65 °C; no heatinactivation after 20 min 80°C | http://www.fermentas.com/catalog/re/taqi.htm |
- HphI seems to be a goog choice since it can be heatinactivated and has no star activity (does not cleave unspecific when DNA is overdigested).
- In unsynchronized cultures the detection of hemimethylation will be difficult. If every GATC is hemimethylated for about 1 min and replication of the chromosome takes about 50 min, than about 2% of a specific GATC will be in a hemimethylated state giving only 1% cut with an overlapping enzyme.
- One possibility to make the restriction outcome higher could be to use sites like ggtgatcacc that have two HphI restriction sites overlapping one GATC. This should give a doubling in cutting at that site compared to only one HphI site. However, a 10bp long inverted repeat might not give a representative result for GATC methylation because some whatever protein could bind there. The E. coli K12 genome contains 33 ggtgatcacc sites:
Start End Pattern_name Mismatch Sequence 118460 118469 pattern1 . GGTGATCACC 143911 143920 pattern1 . GGTGATCACC 210581 210590 pattern1 . GGTGATCACC 282472 282481 pattern1 . GGTGATCACC 330621 330630 pattern1 . GGTGATCACC 379605 379614 pattern1 . GGTGATCACC 405197 405206 pattern1 . GGTGATCACC 599247 599256 pattern1 . GGTGATCACC 636380 636389 pattern1 . GGTGATCACC 681039 681048 pattern1 . GGTGATCACC 685084 685093 pattern1 . GGTGATCACC 712647 712656 pattern1 . GGTGATCACC 826095 826104 pattern1 . GGTGATCACC 834158 834167 pattern1 . GGTGATCACC 854836 854845 pattern1 . GGTGATCACC 900826 900835 pattern1 . GGTGATCACC 1065260 1065269 pattern1 . GGTGATCACC 1107328 1107337 pattern1 . GGTGATCACC 1363023 1363032 pattern1 . GGTGATCACC 2152717 2152726 pattern1 . GGTGATCACC 2358426 2358435 pattern1 . GGTGATCACC 2540379 2540388 pattern1 . GGTGATCACC 2953039 2953048 pattern1 . GGTGATCACC 3010031 3010040 pattern1 . GGTGATCACC 3042067 3042076 pattern1 . GGTGATCACC 3268923 3268932 pattern1 . GGTGATCACC 3528134 3528143 pattern1 . GGTGATCACC 3540084 3540093 pattern1 . GGTGATCACC 3607305 3607314 pattern1 . GGTGATCACC 3858080 3858089 pattern1 . GGTGATCACC 4238710 4238719 pattern1 . GGTGATCACC 4292770 4292779 pattern1 . GGTGATCACC 4463247 4463256 pattern1 . GGTGATCACC
Name (localisation of HphI site) | feature in this region | MseI sites | GATCs | Sequence | Size of MseI fragment | Oligos for qPCR | |
---|---|---|---|---|---|---|---|
761873 | sucB CDS | 761873_P CGAATCCGTGGGCTTCCTGG 761873_fw GAGATCCTGCCGATGATGTA 761873_rv TTCCAGCAACTCTTTGATCG |
- Løbner-Olesen A, Marinus MG, and Hansen FG. Role of SeqA and Dam in Escherichia coli gene expression: a global/microarray analysis. Proc Natl Acad Sci U S A. 2003 Apr 15;100(8):4672-7. DOI:10.1073/pnas.0538053100 |
- Løbner-Olesen A, Boye E, and Marinus MG. Expression of the Escherichia coli dam gene. Mol Microbiol. 1992 Jul;6(13):1841-51. DOI:10.1111/j.1365-2958.1992.tb01356.x |
- Pfister S, Schlaeger C, Mendrzyk F, Wittmann A, Benner A, Kulozik A, Scheurlen W, Radlwimmer B, and Lichter P. Array-based profiling of reference-independent methylation status (aPRIMES) identifies frequent promoter methylation and consecutive downregulation of ZIC2 in pediatric medulloblastoma. Nucleic Acids Res. 2007;35(7):e51. DOI:10.1093/nar/gkm094 |
- Braun RE and Wright A. DNA methylation differentially enhances the expression of one of the two E. coli dnaA promoters in vivo and in vitro. Mol Gen Genet. 1986 Feb;202(2):246-50. DOI:10.1007/BF00331644 |
- Kücherer C, Lother H, Kölling R, Schauzu MA, and Messer W. Regulation of transcription of the chromosomal dnaA gene of Escherichia coli. Mol Gen Genet. 1986 Oct;205(1):115-21. DOI:10.1007/BF02428040 |
- Campbell JL and Kleckner N. E. coli oriC and the dnaA gene promoter are sequestered from dam methyltransferase following the passage of the chromosomal replication fork. Cell. 1990 Sep 7;62(5):967-79. DOI:10.1016/0092-8674(90)90271-f |