User:Torsten Waldminghaus/Notebook/Methylation array

Idea

• Analyse the methylation of GATC sites genomewide in E. coli.

Notes

• Løbner-Olesen et al, 2003 [1] used a aroK17::cat strain to have more hemimethylation in the cell, since a polar effect on dam leads to a reduced Dam content in the cell (only 30% of wt [2]). Could be used as control and for interesting analysis.
• methylation in different strains could be interesting:
  • dam-overproduction
  • seqA deletion, over-production, under-production
  • synchronized cells
  • does introduction of a GATC cluster alter methylation of surrounding sites?
• what about GATC sites in datA? sequestration?
• one could compare methylation in protein coding regions with intergenic regions and RNA coding.
• one could analyse effect of distance to oriC and density of GATCs

• REN to cut the chrom. DNA in the first step could be MseI which was used before [3]. It cuts TTAA and can be heat inactivated at 65 °C for 20 min (http://www.neb.com/nebecomm/products/productR0525.asp).

• As independent method and first step one could analyse cutting by methylation sensitive REN with qPCR
  • on whole chromosome
  • clusters and isolated GATCs
  • coding regions and intergenic regions

Possible restriction enzymes that are Dam methylation sensitive:

Enzyme	Site	Notes	Link
HphI	GGTGA	No star activity; reaction at 37°C; heatinactivation at 20 min 65°C	http://www.fermentas.com/catalog/re/hphi.htm
MboII	GAAGA	Star activity; reaction at 37°C; heatinactivation at 20 min 65°C	http://www.fermentas.com/catalog/re/mboii.htm
TaqI	TCGA	No star activity; reaction at 65 °C; no heatinactivation after 20 min 80°C	http://www.fermentas.com/catalog/re/taqi.htm

• HphI seems to be a good choice since it can be heatinactivated and has no star activity (does not cleave unspecific when DNA is overdigested).
• In unsynchronized cultures the detection of hemimethylation will be difficult. If every GATC is hemimethylated for about 1 min and replication of the chromosome takes about 50 min, than about 2% of a specific GATC will be in a hemimethylated state giving only 1% cut with an overlapping enzyme.
  • One possibility to make the restriction outcome higher could be to use sites like ggtgatcacc that have two HphI restriction sites overlapping one GATC. This should give a doubling in cutting at that site compared to only one HphI site. However, a 10bp long inverted repeat might not give a representative result for GATC methylation because some whatever protein could bind there. The E. coli K12 genome contains 33 ggtgatcacc sites:

Start     End Pattern_name Mismatch Sequence
118460  118469 pattern1            . GGTGATCACC
143911  143920 pattern1            . GGTGATCACC
210581  210590 pattern1            . GGTGATCACC
282472  282481 pattern1            . GGTGATCACC
330621  330630 pattern1            . GGTGATCACC
379605  379614 pattern1            . GGTGATCACC
405197  405206 pattern1            . GGTGATCACC
599247  599256 pattern1            . GGTGATCACC
636380  636389 pattern1            . GGTGATCACC
681039  681048 pattern1            . GGTGATCACC
685084  685093 pattern1            . GGTGATCACC
712647  712656 pattern1            . GGTGATCACC
826095  826104 pattern1            . GGTGATCACC
834158  834167 pattern1            . GGTGATCACC
854836  854845 pattern1            . GGTGATCACC
900826  900835 pattern1            . GGTGATCACC
1065260 1065269 pattern1            . GGTGATCACC
1107328 1107337 pattern1            . GGTGATCACC
1363023 1363032 pattern1            . GGTGATCACC
2152717 2152726 pattern1            . GGTGATCACC
2358426 2358435 pattern1            . GGTGATCACC
2540379 2540388 pattern1            . GGTGATCACC
2953039 2953048 pattern1            . GGTGATCACC
3010031 3010040 pattern1            . GGTGATCACC
3042067 3042076 pattern1            . GGTGATCACC
3268923 3268932 pattern1            . GGTGATCACC
3528134 3528143 pattern1            . GGTGATCACC
3540084 3540093 pattern1            . GGTGATCACC
3607305 3607314 pattern1            . GGTGATCACC
3858080 3858089 pattern1            . GGTGATCACC
4238710 4238719 pattern1            . GGTGATCACC
4292770 4292779 pattern1            . GGTGATCACC
4463247 4463256 pattern1            . GGTGATCACC

• found with http://mobyle.pasteur.fr/cgi-bin/MobylePortal/portal.py?form=fuzznuc

Name (localisation of HphI site)	feature in this region	MseI sites	GATCs	Sequence	Size of MseI fragment	Oligos for qPCR
761873	sucB CDS					761873_P CGAATCCGTGGGCTTCCTGG 761873_fw GAGATCCTGCCGATGATGTA 761873_rv TTCCAGCAACTCTTTGATCG

• One other possibility to check the hemimethylation in general is to isolate chrom. DNA and than methylate it with radioactive SAM. The amount of incorparated radioactivity should be proportianal to the hemi or unmethylated DNA. As control one could use the same DNA that was incubated with Dam and non radioactive SAM before. Defined substrates as for example a plasmid from dam- strain could help to normalize the found radioactivity and calculate how many GATCs were hemimethylated.

Protocol REN-qPCR

Isolate DNA from MG1655

• grow cells
• take 2x 10ml samples at OD 0.15 and transfer directly to 10 ml TE with 3% SDS at 65 °C (7ml TE + 3ml 10% SDS)
• leave at 65 °C for 5 min
• add 10 ml Isopropanol and store at -80 °C for 30 min
• centrifuge hith speed for 20 min
• wash in 70% ethanol and transfer to 2 ml reaction tubes
• resuspend in 200 μL A. dest
• add 1 μL RNase A (27.5 mg/ml) and incubate 30 min at 65 °C
• add 10 μL proteinase K (20 mg/ml) 1h at 50 °C (endconcentration = 1 mg/ml).
• extract with phenol/chlorophorm
• preciptitate with ehanol and Na-acetate
• resuspend in 50 μL A. dest and meassure at Nanodrop

Protocol Methylation Array

MseI Restriction

• Digest 500ng chrom. DNA with 10U of MseI in 10μL volume for 3h.
• Heat inactivate for 20 min at 65°C

Linker Ligation

• Annealing of oligos MseILong (5' AGTGGGATTCCGCATGCTAGT 3') and MseIShort (5' TAACTAGCATCG 3')[4]:
  • Mix 1μL of 100μM (=100pmol/μL) stocks of both primers with 4μL H₂O in PCR tube
  • Run program starting at 75°C and cooling down to 15°C with 1°C per 2 minutes.
• At 15°C add 10μL MseI cut DNA, 2μL Ligase Buffer and 2μL Ligase
• Ligate over night

One elongation round

1. Løbner-Olesen A, Marinus MG, and Hansen FG. Role of SeqA and Dam in Escherichia coli gene expression: a global/microarray analysis. Proc Natl Acad Sci U S A. 2003 Apr 15;100(8):4672-7. DOI:10.1073/pnas.0538053100 |
2. Løbner-Olesen A, Boye E, and Marinus MG. Expression of the Escherichia coli dam gene. Mol Microbiol. 1992 Jul;6(13):1841-51. DOI:10.1111/j.1365-2958.1992.tb01356.x |
3. Pfister S, Schlaeger C, Mendrzyk F, Wittmann A, Benner A, Kulozik A, Scheurlen W, Radlwimmer B, and Lichter P. Array-based profiling of reference-independent methylation status (aPRIMES) identifies frequent promoter methylation and consecutive downregulation of ZIC2 in pediatric medulloblastoma. Nucleic Acids Res. 2007;35(7):e51. DOI:10.1093/nar/gkm094 |
4. Watson SK, deLeeuw RJ, Ishkanian AS, Malloff CA, and Lam WL. Methods for high throughput validation of amplified fragment pools of BAC DNA for constructing high resolution CGH arrays. BMC Genomics. 2004 Jan 14;5(1):6. DOI:10.1186/1471-2164-5-6 |
5. Braun RE and Wright A. DNA methylation differentially enhances the expression of one of the two E. coli dnaA promoters in vivo and in vitro. Mol Gen Genet. 1986 Feb;202(2):246-50. DOI:10.1007/BF00331644 |
6. Kücherer C, Lother H, Kölling R, Schauzu MA, and Messer W. Regulation of transcription of the chromosomal dnaA gene of Escherichia coli. Mol Gen Genet. 1986 Oct;205(1):115-21. DOI:10.1007/BF02428040 |
7. Campbell JL and Kleckner N. E. coli oriC and the dnaA gene promoter are sequestered from dam methyltransferase following the passage of the chromosomal replication fork. Cell. 1990 Sep 7;62(5):967-79. DOI:10.1016/0092-8674(90)90271-f |
8. Riber L, Olsson JA, Jensen RB, Skovgaard O, Dasgupta S, Marinus MG, and Løbner-Olesen A. Hda-mediated inactivation of the DnaA protein and dnaA gene autoregulation act in concert to ensure homeostatic maintenance of the Escherichia coli chromosome. Genes Dev. 2006 Aug 1;20(15):2121-34. DOI:10.1101/gad.379506 |
9. Bart A, van Passel MW, van Amsterdam K, and van der Ende A. Direct detection of methylation in genomic DNA. Nucleic Acids Res. 2005 Aug 9;33(14):e124. DOI:10.1093/nar/gni121 |
10. Rao BS and Buckler-White A. Direct visualization of site-specific and strand-specific DNA methylation patterns in automated DNA sequencing data. Nucleic Acids Res. 1998 May 15;26(10):2505-7. DOI:10.1093/nar/26.10.2505 |