User:Torsten Waldminghaus/ds-oligos

From OpenWetWare

< User:Torsten Waldminghaus(Difference between revisions)
Jump to: navigation, search
(New page: *All oligos are two annealed strands and are in concentrations of 100pmol/μL {| border="3" ! Name !! Sequence 1 !! Sequence 2!! Characteristics !!Oligo number |- ! half-linker A |GGCCGCG...)
Current revision (09:17, 24 August 2011) (view source)
 
Line 28: Line 28:
|4
|4
|-
|-
-
!  
+
! In1
-
|
+
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTACATGxT
-
|
+
|P-CATGTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
-
|
+
|x=Phosphorothioate linkage; P=phosphate
-
|
+
|5
|-
|-
-
!  
+
! In2
-
|
+
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTACGATxT
-
|
+
|P-ATCGTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
-
|
+
|x=Phosphorothioate linkage; P=phosphate
-
|
+
|6
|-
|-
-
!  
+
! In3
-
|
+
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTCAxT
-
|
+
|P-TGACTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
-
|
+
|x=Phosphorothioate linkage; P=phosphate
-
|
+
|7
|-
|-
-
!  
+
! In4
-
|
+
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCAGTxT
-
|
+
|P-ACTGGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
-
|
+
|x=Phosphorothioate linkage; P=phosphate
-
|
+
|8
|-
|-
-
!  
+
! In5
-
|
+
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGACxT
-
|
+
|P-GTCAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
-
|
+
|x=Phosphorothioate linkage; P=phosphate
-
|
+
|9
|-
|-
-
!  
+
! In6
-
|
+
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTTGAxT
-
|
+
|P-TCAAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
-
|
+
|x=Phosphorothioate linkage; P=phosphate
-
|
+
|10
|-
|-
-
!  
+
! In7
-
|
+
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACCTxT
-
|
+
|P-AGGTCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
-
|
+
|x=Phosphorothioate linkage; P=phosphate
 +
|11
 +
|-
 +
! In8
 +
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTGATGCxT
 +
|P-GCATCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
 +
|x=Phosphorothioate linkage; P=phosphate
 +
|12
 +
|-
 +
! In9
 +
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCAGxT
 +
|P-CTGACAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
 +
|x=Phosphorothioate linkage; P=phosphate
 +
|13
 +
|-
 +
! In10
 +
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTTAGTCxT
 +
|P-GACTAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
 +
|x=Phosphorothioate linkage; P=phosphate
 +
|14
 +
|-
 +
! In11
 +
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGACGxT
 +
|P-CGTCAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
|
|
 +
|15
|-
|-
-
!  
+
! In12
-
|
+
|ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCTAxT
-
|
+
|P-TAGCAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
-
|
+
|x=Phosphorothioate linkage; P=phosphate
-
|
+
|16
|-
|-
}
}

Current revision

  • All oligos are two annealed strands and are in concentrations of 100pmol/μL
}
Name Sequence 1 Sequence 2 Characteristics Oligo number
half-linker A GGCCGCGATATCTTATCCAACxT P-GTTGGATAAGATATCGC bold=biotin label; x=Phosphorothioate linkage; P=phosphate 1
half-linker B GGCCGCGATATACATTCCAACxT P-GTTGGAATGTATATCGC bold=biotin label; x=Phosphorothioate linkage; P=phosphate 2
half-linker no GGCCGCGATATCTTATCCAAC GTTGGATAAGATATCGC 3
ChIA-PET Illumina adapter ACACTCTTTCCCTACACGACGCTCTTCCGATCTNxN AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage 4
In1 ACACTCTTTCCCTACACGACGCTCTTCCGATCTACATGxT P-CATGTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 5
In2 ACACTCTTTCCCTACACGACGCTCTTCCGATCTACGATxT P-ATCGTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 6
In3 ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTCAxT P-TGACTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 7
In4 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCAGTxT P-ACTGGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 8
In5 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGACxT P-GTCAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 9
In6 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTTGAxT P-TCAAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 10
In7 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACCTxT P-AGGTCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 11
In8 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGATGCxT P-GCATCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 12
In9 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCAGxT P-CTGACAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 13
In10 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTAGTCxT P-GACTAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 14
In11 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGACGxT P-CGTCAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 15
In12 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCTAxT P-TAGCAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 16
Personal tools