User:Torsten Waldminghaus/ds-oligos

From OpenWetWare

< User:Torsten Waldminghaus
Revision as of 10:17, 24 August 2011 by Torsten Waldminghaus (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
  • All oligos are two annealed strands and are in concentrations of 100pmol/μL
}
Name Sequence 1 Sequence 2 Characteristics Oligo number
half-linker A GGCCGCGATATCTTATCCAACxT P-GTTGGATAAGATATCGC bold=biotin label; x=Phosphorothioate linkage; P=phosphate 1
half-linker B GGCCGCGATATACATTCCAACxT P-GTTGGAATGTATATCGC bold=biotin label; x=Phosphorothioate linkage; P=phosphate 2
half-linker no GGCCGCGATATCTTATCCAAC GTTGGATAAGATATCGC 3
ChIA-PET Illumina adapter ACACTCTTTCCCTACACGACGCTCTTCCGATCTNxN AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage 4
In1 ACACTCTTTCCCTACACGACGCTCTTCCGATCTACATGxT P-CATGTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 5
In2 ACACTCTTTCCCTACACGACGCTCTTCCGATCTACGATxT P-ATCGTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 6
In3 ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTCAxT P-TGACTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 7
In4 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCAGTxT P-ACTGGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 8
In5 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGACxT P-GTCAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 9
In6 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTTGAxT P-TCAAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 10
In7 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACCTxT P-AGGTCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 11
In8 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGATGCxT P-GCATCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 12
In9 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCAGxT P-CTGACAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 13
In10 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTAGTCxT P-GACTAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 14
In11 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGACGxT P-CGTCAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 15
In12 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCTAxT P-TAGCAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG x=Phosphorothioate linkage; P=phosphate 16
Personal tools