User:Torsten Waldminghaus/ds-oligos

From OpenWetWare

Jump to: navigation, search
  • All oligos are two annealed strands and are in concentrations of 100pmol/μL
Name Sequence 1 Sequence 2 Characteristics Oligo number
half-linker A GGCCGCGATATCTTATCCAACxT P-GTTGGATAAGATATCGC bold=biotin label; x=Phosphorothioate linkage; P=phosphate 1
half-linker B GGCCGCGATATACATTCCAACxT P-GTTGGAATGTATATCGC bold=biotin label; x=Phosphorothioate linkage; P=phosphate 2
Personal tools