User:Torsten Waldminghaus/qPCR-Primers

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(New page: {| border="3" ! Name !! Sequence !! Characteristics !! |- ! uvrDfw | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>) |- ! uvrDrv ...)
Line 4: Line 4:
! uvrDfw
! uvrDfw
| AGTTCCCGCAGGTGTTTATC
| AGTTCCCGCAGGTGTTTATC
-
| qPCR for uvrD-region with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)
+
| qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)
|-
|-
! uvrDrv   
! uvrDrv   
|GTCAGCGTCAGTTTCTGCAT
|GTCAGCGTCAGTTTCTGCAT
-
|qPCR for uvrD-region with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)
+
|qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)
|-
|-
!uvrDprobe   
!uvrDprobe   
|AGACGCCCGCCTTCATCCAG
|AGACGCCCGCCTTCATCCAG
-
|HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region with no GATC-sites (Region B from Yamazoe et al., 200
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>
 +
|-
 +
! yahEFfw
 +
| CCATCGAGACGATCAAAGAA
 +
| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>)
 +
|-
 +
! yahEFrv
 +
| CAGCATCTGGCTTTGTTGTT
 +
| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>)
 +
|-
 +
! yahEFprobe
 +
| AACTCGCGTCCTTCGGCAGC
 +
| HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>)
 +
|-
 +
!cluster-fw
 +
|CTGACTGATGAGATCCAACGA
 +
|qPCR for GATC-cluster
 +
!cluster-rv
 +
|CTGGTGCTACGCCTGAATAA
 +
|qPCR for GATC-cluster
 +
!cluster-p
 +
|AAATTCGACCCGGCTGTCGC
 +
|qPCR for GATC-cluster
|}
|}

Revision as of 04:30, 16 December 2008

Name Sequence Characteristics
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1])
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1])
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1]
yahEFfw CCATCGAGACGATCAAAGAA qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])
yahEFrv CAGCATCTGGCTTTGTTGTT qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])
yahEFprobe AACTCGCGTCCTTCGGCAGC HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])
cluster-fw CTGACTGATGAGATCCAACGA qPCR for GATC-cluster cluster-rv CTGGTGCTACGCCTGAATAA qPCR for GATC-cluster cluster-p AAATTCGACCCGGCTGTCGC qPCR for GATC-cluster


  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935. PubMed HubMed [Yamazoe-2005]
Personal tools