User:Torsten Waldminghaus/qPCR-Primers: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(New page: {| border="3" ! Name !! Sequence !! Characteristics !! |- ! uvrDfw | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>) |- ! uvrDrv ...) |
No edit summary |
||
Line 4: | Line 4: | ||
! uvrDfw | ! uvrDfw | ||
| AGTTCCCGCAGGTGTTTATC | | AGTTCCCGCAGGTGTTTATC | ||
| qPCR for uvrD-region | | qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from <cite>Yamazoe-2005</cite>) | ||
|- | |- | ||
! uvrDrv | ! uvrDrv | ||
|GTCAGCGTCAGTTTCTGCAT | |GTCAGCGTCAGTTTCTGCAT | ||
|qPCR for uvrD-region | |qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from <cite>Yamazoe-2005</cite>) | ||
|- | |- | ||
!uvrDprobe | !uvrDprobe | ||
|AGACGCCCGCCTTCATCCAG | |AGACGCCCGCCTTCATCCAG | ||
|HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region with no GATC-sites (Region B from Yamazoe | |HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite> | ||
|- | |||
! yahEFfw | |||
| CCATCGAGACGATCAAAGAA | |||
| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>) | |||
|- | |||
! yahEFrv | |||
| CAGCATCTGGCTTTGTTGTT | |||
| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>) | |||
|- | |||
! yahEFprobe | |||
| AACTCGCGTCCTTCGGCAGC | |||
| HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>) | |||
|- | |||
!cluster-fw | |||
|CTGACTGATGAGATCCAACGA | |||
|qPCR for GATC-cluster | |||
!cluster-rv | |||
|CTGGTGCTACGCCTGAATAA | |||
|qPCR for GATC-cluster | |||
!cluster-p | |||
|AAATTCGACCCGGCTGTCGC | |||
|qPCR for GATC-cluster | |||
|} | |} | ||
Revision as of 02:30, 16 December 2008
Name | Sequence | Characteristics | ||||||
---|---|---|---|---|---|---|---|---|
uvrDfw | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) | ||||||
uvrDrv | GTCAGCGTCAGTTTCTGCAT | qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) | ||||||
uvrDprobe | AGACGCCCGCCTTCATCCAG | HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1] | ||||||
yahEFfw | CCATCGAGACGATCAAAGAA | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | ||||||
yahEFrv | CAGCATCTGGCTTTGTTGTT | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | ||||||
yahEFprobe | AACTCGCGTCCTTCGGCAGC | HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | ||||||
cluster-fw | CTGACTGATGAGATCCAACGA | qPCR for GATC-cluster | cluster-rv | CTGGTGCTACGCCTGAATAA | qPCR for GATC-cluster | cluster-p | AAATTCGACCCGGCTGTCGC | qPCR for GATC-cluster |