User:Torsten Waldminghaus/qPCR-Primers

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 29: Line 29:
|qPCR for GATC-cluster  
|qPCR for GATC-cluster  
|qPCR for GATC-cluster  
|qPCR for GATC-cluster  
|qPCR for GATC-cluster  
|qPCR for GATC-cluster  

Revision as of 04:31, 16 December 2008

Name Sequence Characteristics
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1])
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1])
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1]
yahEFfw CCATCGAGACGATCAAAGAA qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])
yahEFrv CAGCATCTGGCTTTGTTGTT qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])
yahEFprobe AACTCGCGTCCTTCGGCAGC HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1])

  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935. PubMed HubMed [Yamazoe-2005]
Personal tools