User:Torsten Waldminghaus/qPCR-Primers

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 50: Line 50:
|CCAGGAAGCCCACGGATTCG
|CCAGGAAGCCCACGGATTCG
|
|
 +
|6
|-
|-
!761139fw
!761139fw
|GAGATCCTGCCGATGATGTA
|GAGATCCTGCCGATGATGTA
|
|
 +
|6
|-
|-
!761139rv
!761139rv
|TTCCAGCAACTCTTTGATCG
|TTCCAGCAACTCTTTGATCG
|
|
 +
|6
|-
|-
!797735fw
!797735fw
|CGTCCTGGCGTATCGTATC
|CGTCCTGGCGTATCGTATC
|
|
 +
|4
|-
|-
!797735rv
!797735rv
|GCATTGTAAGAACCTACAAAGACAA
|GCATTGTAAGAACCTACAAAGACAA
|
|
 +
|4
|-
|-
!797735p
!797735p
|TTTGCCGCAGAGTCTGCGCT
|TTTGCCGCAGAGTCTGCGCT
|
|
 +
|4
|-
|-
!1504230fw
!1504230fw
|CGCCTTCAGTTTATGATCCA
|CGCCTTCAGTTTATGATCCA
|
|
 +
|13
|-
|-
!1504230rv
!1504230rv
|TCGAGAAGTGTTCAAAGCAGA
|TCGAGAAGTGTTCAAAGCAGA
|
|
 +
|13
|-
|-
!1504230p
!1504230p
|TGATCACCATCGCCTGCTGTTG
|TGATCACCATCGCCTGCTGTTG
|
|
 +
|13
|-
|-
!1514191fw
!1514191fw
|ATACTGTTTGGCAGAGGCAA
|ATACTGTTTGGCAGAGGCAA
|
|
 +
|12
|-
|-
!1514191rv
!1514191rv
|GGTATGGCTGATGATGTGCT
|GGTATGGCTGATGATGTGCT
|
|
 +
|12
|-
|-
!1514191p
!1514191p
|TGACCGGTCAGCGGATCACC
|TGACCGGTCAGCGGATCACC
|
|
 +
|12
|-
|-
!2318305fw
!2318305fw
|ATAATCACCTACGCGCCTTC
|ATAATCACCTACGCGCCTTC
|
|
 +
|5
|-
|-
!2318305rv
!2318305rv
|ACCTGCCTGCCTGAATAAAC
|ACCTGCCTGCCTGAATAAAC
|
|
 +
|5
|-
|-
!2318305p
!2318305p
|TGCCGCAGATCACCCTGGTC
|TGCCGCAGATCACCCTGGTC
|
|
 +
|5
|-
|-
!2351285fw
!2351285fw
|ACACATTGCCGAATATGCC
|ACACATTGCCGAATATGCC
|
|
 +
|16
|-
|-
!2351285rv
!2351285rv
|GTTAATGCGGTGATCCATGA
|GTTAATGCGGTGATCCATGA
|
|
 +
|16
|-
|-
!2351285p
!2351285p
|CTGCGCATTCGCATGTTCCC
|CTGCGCATTCGCATGTTCCC
|
|
 +
|16
 +
|-
 +
!2923803fw
 +
|GTCAGCCACCTGCTGAAAT
 +
|
 +
|15
 +
|-
 +
!2923803rv
 +
|ATACTGAATTTGGAGCGAACC
 +
|
 +
|15
 +
|-
 +
!2923803p
 +
|TGCCTGATCACCCATCAACCAGA
 +
|
 +
|15
 +
|-
 +
!2952960fw
 +
|CTACTGTTTCGCGGATCTCA
 +
|
 +
|8
 +
|-
 +
!2952960rv
 +
|CAACTGCTTGCAGAACCATT
 +
|
 +
|8
 +
|-
 +
!2952960p
 +
|CTGGTGATCACCCGCGCATT
 +
|
 +
|8
 +
|-
 +
!3923874fw
 +
|GCCCTGTGGATAACAAGGAT
 +
|
 +
|18
 +
|-
 +
!3923874rv
 +
|CCTCATTCTGATCCCAGCTT
 +
|
 +
|18
 +
|-
 +
!3923874p
 +
|CGGTCCAGGATCACCGATCATTC
 +
|
 +
|18
 +
|-
 +
!3921366fw
 +
|GAGAATATGGCGTACCAGCA
 +
|
 +
|7
 +
|-
 +
!3921366rv
 +
|AAGACGCAGGTATTTCGCTT
 +
|
 +
|7
 +
|-
 +
!3921366p
 +
|CAACCTGACTTCGGTCCGCG
 +
|
 +
|7
 +
|-
 +
!4301774fw
 +
|CTGAATAACTCGCCTCGTGA
 +
|
 +
|10
 +
|-
 +
!4301774rv
 +
|ATTCCCGTCTTCATGGTTTC
 +
|
 +
|10
 +
|-
 +
!4301774p
 +
|TAAGCGCCGATCACCGGGAT
 +
|
 +
|10
 +
|-
 +
!4321507fw
 +
|AGCCAGAGGTGGAGTTAGGA
 +
|
 +
|9
 +
|-
 +
!4321507rv
 +
|ACAACCTGAACGATCTGCTG
 +
|
 +
|9
 +
|-
 +
!4321507p
 +
|TCTCACCTTTGGCAATGGCGA
 +
|
 +
|9
 +
|-
 +
!ter-fw
 +
|TCCTCGCTGTTTGTCATCTT
 +
|
 +
|17
 +
|-
 +
!ter-rv
 +
|GGTCTTGCTCGAATCCCTT
 +
|
 +
|17
 +
|-
 +
!ter-p
 +
|CATCAGCACCCACGCAGCAA
 +
|
 +
|17
|-
|-
|}
|}

Revision as of 06:06, 16 December 2008

Name Sequence Characteristics Probe set number
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1] 1
yahEFfw CCATCGAGACGATCAAAGAA qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFrv CAGCATCTGGCTTTGTTGTT qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFprobe AACTCGCGTCCTTCGGCAGC HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
cluster-fw CTGACTGATGAGATCCAACGA qPCR for GATC-cluster 14
cluster-rv CTGGTGCTACGCCTGAATAA qPCR for GATC-cluster 14
cluster-p AAATTCGACCCGGCTGTCGC qPCR for GATC-cluster 14
761139p CCAGGAAGCCCACGGATTCG 6
761139fw GAGATCCTGCCGATGATGTA 6
761139rv TTCCAGCAACTCTTTGATCG 6
797735fw CGTCCTGGCGTATCGTATC 4
797735rv GCATTGTAAGAACCTACAAAGACAA 4
797735p TTTGCCGCAGAGTCTGCGCT 4
1504230fw CGCCTTCAGTTTATGATCCA 13
1504230rv TCGAGAAGTGTTCAAAGCAGA 13
1504230p TGATCACCATCGCCTGCTGTTG 13
1514191fw ATACTGTTTGGCAGAGGCAA 12
1514191rv GGTATGGCTGATGATGTGCT 12
1514191p TGACCGGTCAGCGGATCACC 12
2318305fw ATAATCACCTACGCGCCTTC 5
2318305rv ACCTGCCTGCCTGAATAAAC 5
2318305p TGCCGCAGATCACCCTGGTC 5
2351285fw ACACATTGCCGAATATGCC 16
2351285rv GTTAATGCGGTGATCCATGA 16
2351285p CTGCGCATTCGCATGTTCCC 16
2923803fw GTCAGCCACCTGCTGAAAT 15
2923803rv ATACTGAATTTGGAGCGAACC 15
2923803p TGCCTGATCACCCATCAACCAGA 15
2952960fw CTACTGTTTCGCGGATCTCA 8
2952960rv CAACTGCTTGCAGAACCATT 8
2952960p CTGGTGATCACCCGCGCATT 8
3923874fw GCCCTGTGGATAACAAGGAT 18
3923874rv CCTCATTCTGATCCCAGCTT 18
3923874p CGGTCCAGGATCACCGATCATTC 18
3921366fw GAGAATATGGCGTACCAGCA 7
3921366rv AAGACGCAGGTATTTCGCTT 7
3921366p CAACCTGACTTCGGTCCGCG 7
4301774fw CTGAATAACTCGCCTCGTGA 10
4301774rv ATTCCCGTCTTCATGGTTTC 10
4301774p TAAGCGCCGATCACCGGGAT 10
4321507fw AGCCAGAGGTGGAGTTAGGA 9
4321507rv ACAACCTGAACGATCTGCTG 9
4321507p TCTCACCTTTGGCAATGGCGA 9
ter-fw TCCTCGCTGTTTGTCATCTT 17
ter-rv GGTCTTGCTCGAATCCCTT 17
ter-p CATCAGCACCCACGCAGCAA 17


  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935. PubMed HubMed [Yamazoe-2005]
Personal tools