User:Torsten Waldminghaus/qPCR-Primers

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 49: Line 49:
!761139p
!761139p
|CCAGGAAGCCCACGGATTCG
|CCAGGAAGCCCACGGATTCG
-
|
+
|qPCR for sucB-region on E. coli chromosome with many GATC-sites
|6
|6
|-
|-
!761139fw
!761139fw
|GAGATCCTGCCGATGATGTA
|GAGATCCTGCCGATGATGTA
-
|
+
|qPCR for sucB-region on E. coli chromosome with many GATC-sites
|6
|6
|-
|-
!761139rv
!761139rv
|TTCCAGCAACTCTTTGATCG
|TTCCAGCAACTCTTTGATCG
-
|
+
|qPCR for sucB-region on E. coli chromosome with many GATC-sites
|6
|6
|-
|-
!797735fw
!797735fw
|CGTCCTGGCGTATCGTATC
|CGTCCTGGCGTATCGTATC
-
|
+
|qPCR for pgl-region on E. coli chromosome with isolated GATC-site
|4
|4
|-
|-
!797735rv
!797735rv
|GCATTGTAAGAACCTACAAAGACAA
|GCATTGTAAGAACCTACAAAGACAA
-
|
+
|qPCR for pgl-region on E. coli chromosome with isolated GATC-site
|4
|4
|-
|-
!797735p
!797735p
|TTTGCCGCAGAGTCTGCGCT
|TTTGCCGCAGAGTCTGCGCT
-
|
+
|qPCR for pgl-region on E. coli chromosome with isolated GATC-site
|4
|4
|-
|-
!1504230fw
!1504230fw
|CGCCTTCAGTTTATGATCCA
|CGCCTTCAGTTTATGATCCA
-
|
+
|qPCR for ydcN-region on E. coli chromosome with many GATC-sites
|13
|13
|-
|-
!1504230rv
!1504230rv
|TCGAGAAGTGTTCAAAGCAGA
|TCGAGAAGTGTTCAAAGCAGA
-
|
+
|qPCR for ydcN-region on E. coli chromosome with many GATC-sites
|13
|13
|-
|-
!1504230p
!1504230p
|TGATCACCATCGCCTGCTGTTG
|TGATCACCATCGCCTGCTGTTG
-
|
+
|qPCR for ydcN-region on E. coli chromosome with many GATC-sites
|13
|13
|-
|-
!1514191fw
!1514191fw
|ATACTGTTTGGCAGAGGCAA
|ATACTGTTTGGCAGAGGCAA
-
|
+
|qPCR for ydcW-region on E. coli chromosome with isolated GATC-site
|12
|12
|-
|-
!1514191rv
!1514191rv
|GGTATGGCTGATGATGTGCT
|GGTATGGCTGATGATGTGCT
-
|
+
|qPCR for ydcW-region on E. coli chromosome with isolated GATC-site
|12
|12
|-
|-
!1514191p
!1514191p
|TGACCGGTCAGCGGATCACC
|TGACCGGTCAGCGGATCACC
-
|
+
|qPCR for ydcW-region on E. coli chromosome with isolated GATC-site
|12
|12
|-
|-
!2318305fw
!2318305fw
|ATAATCACCTACGCGCCTTC
|ATAATCACCTACGCGCCTTC
-
|
+
|qPCR for atoSC-region on E. coli chromosome with isolated GATC-site
|5
|5
|-
|-
!2318305rv
!2318305rv
|ACCTGCCTGCCTGAATAAAC
|ACCTGCCTGCCTGAATAAAC
-
|
+
|qPCR for atoSC-region on E. coli chromosome with isolated GATC-site
|5
|5
|-
|-
!2318305p
!2318305p
|TGCCGCAGATCACCCTGGTC
|TGCCGCAGATCACCCTGGTC
-
|
+
|qPCR for atoSC-region on E. coli chromosome with isolated GATC-site
|5
|5
|-
|-
!2351285fw
!2351285fw
|ACACATTGCCGAATATGCC
|ACACATTGCCGAATATGCC
-
|
+
|qPCR for glpAB-region on E. coli chromosome with many GATC-sites
|16
|16
|-
|-
!2351285rv
!2351285rv
|GTTAATGCGGTGATCCATGA
|GTTAATGCGGTGATCCATGA
-
|
+
|qPCR for glpAB-region on E. coli chromosome with many GATC-sites
|16
|16
|-
|-
!2351285p
!2351285p
|CTGCGCATTCGCATGTTCCC
|CTGCGCATTCGCATGTTCCC
-
|
+
|qPCR for glpAB-region on E. coli chromosome with many GATC-sites
|16
|16
|-
|-
!2923803fw
!2923803fw
|GTCAGCCACCTGCTGAAAT
|GTCAGCCACCTGCTGAAAT
-
|
+
|qPCR for queF-region on E. coli chromosome with isolated GATC-site
|15
|15
|-
|-
!2923803rv
!2923803rv
|ATACTGAATTTGGAGCGAACC
|ATACTGAATTTGGAGCGAACC
-
|
+
|qPCR for queF-region on E. coli chromosome with isolated GATC-site
|15
|15
|-
|-
!2923803p
!2923803p
|TGCCTGATCACCCATCAACCAGA
|TGCCTGATCACCCATCAACCAGA
-
|
+
|qPCR for queF-region on E. coli chromosome with isolated GATC-site
|15
|15
|-
|-
!2952960fw
!2952960fw
|CTACTGTTTCGCGGATCTCA
|CTACTGTTTCGCGGATCTCA
-
|
+
|qPCR for recD-region on E. coli chromosome with many GATC-sites
|8
|8
|-
|-
!2952960rv
!2952960rv
|CAACTGCTTGCAGAACCATT
|CAACTGCTTGCAGAACCATT
-
|
+
|qPCR for recD-region on E. coli chromosome with many GATC-sites
|8
|8
|-
|-
!2952960p
!2952960p
|CTGGTGATCACCCGCGCATT
|CTGGTGATCACCCGCGCATT
-
|
+
|qPCR for recD-region on E. coli chromosome with many GATC-sites
|8
|8
|-
|-
!3923874fw
!3923874fw
|GCCCTGTGGATAACAAGGAT
|GCCCTGTGGATAACAAGGAT
-
|
+
|qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites
|18
|18
|-
|-
!3923874rv
!3923874rv
|CCTCATTCTGATCCCAGCTT
|CCTCATTCTGATCCCAGCTT
-
|
+
|qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites
|18
|18
|-
|-
!3923874p
!3923874p
|CGGTCCAGGATCACCGATCATTC
|CGGTCCAGGATCACCGATCATTC
-
|
+
|qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites
|18
|18
|-
|-
!3921366fw
!3921366fw
|GAGAATATGGCGTACCAGCA
|GAGAATATGGCGTACCAGCA
-
|
+
|qPCR for gidB-region on E. coli chromosome with isolated GATC-site
|7
|7
|-
|-
!3921366rv
!3921366rv
|AAGACGCAGGTATTTCGCTT
|AAGACGCAGGTATTTCGCTT
-
|
+
|qPCR for gidB-region on E. coli chromosome with isolated GATC-site
|7
|7
|-
|-
!3921366p
!3921366p
|CAACCTGACTTCGGTCCGCG
|CAACCTGACTTCGGTCCGCG
-
|
+
|qPCR for gidB-region on E. coli chromosome with isolated GATC-site
|7
|7
|-
|-
!4301774fw
!4301774fw
|CTGAATAACTCGCCTCGTGA
|CTGAATAACTCGCCTCGTGA
-
|
+
|qPCR for mdtO-region on E. coli chromosome with isolated GATC-site
|10
|10
|-
|-
!4301774rv
!4301774rv
|ATTCCCGTCTTCATGGTTTC
|ATTCCCGTCTTCATGGTTTC
-
|
+
|qPCR for mdtO-region on E. coli chromosome with isolated GATC-site
|10
|10
|-
|-
!4301774p
!4301774p
|TAAGCGCCGATCACCGGGAT
|TAAGCGCCGATCACCGGGAT
-
|
+
|qPCR for mdtO-region on E. coli chromosome with isolated GATC-site
|10
|10
|-
|-
!4321507fw
!4321507fw
|AGCCAGAGGTGGAGTTAGGA
|AGCCAGAGGTGGAGTTAGGA
-
|
+
|qPCR for phnD-region on E. coli chromosome with many GATC-sites
|9
|9
|-
|-
!4321507rv
!4321507rv
|ACAACCTGAACGATCTGCTG
|ACAACCTGAACGATCTGCTG
-
|
+
|qPCR for phnD-region on E. coli chromosome with many GATC-sites
|9
|9
|-
|-
!4321507p
!4321507p
|TCTCACCTTTGGCAATGGCGA
|TCTCACCTTTGGCAATGGCGA
-
|
+
|qPCR for phnD-region on E. coli chromosome with many GATC-sites
|9
|9
|-
|-
!ter-fw
!ter-fw
|TCCTCGCTGTTTGTCATCTT
|TCCTCGCTGTTTGTCATCTT
-
|
+
|qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site
|17
|17
|-
|-
!ter-rv
!ter-rv
|GGTCTTGCTCGAATCCCTT
|GGTCTTGCTCGAATCCCTT
-
|
+
|qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site
|17
|17
|-
|-
!ter-p
!ter-p
|CATCAGCACCCACGCAGCAA
|CATCAGCACCCACGCAGCAA
-
|
+
|qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site
|17
|17
|-
|-

Revision as of 06:21, 16 December 2008

Name Sequence Characteristics Probe set number
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1] 1
yahEFfw CCATCGAGACGATCAAAGAA qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFrv CAGCATCTGGCTTTGTTGTT qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFprobe AACTCGCGTCCTTCGGCAGC HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
cluster-fw CTGACTGATGAGATCCAACGA qPCR for GATC-cluster 14
cluster-rv CTGGTGCTACGCCTGAATAA qPCR for GATC-cluster 14
cluster-p AAATTCGACCCGGCTGTCGC qPCR for GATC-cluster 14
761139p CCAGGAAGCCCACGGATTCG qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
761139fw GAGATCCTGCCGATGATGTA qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
761139rv TTCCAGCAACTCTTTGATCG qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
797735fw CGTCCTGGCGTATCGTATC qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
797735rv GCATTGTAAGAACCTACAAAGACAA qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
797735p TTTGCCGCAGAGTCTGCGCT qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
1504230fw CGCCTTCAGTTTATGATCCA qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1504230rv TCGAGAAGTGTTCAAAGCAGA qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1504230p TGATCACCATCGCCTGCTGTTG qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1514191fw ATACTGTTTGGCAGAGGCAA qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
1514191rv GGTATGGCTGATGATGTGCT qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
1514191p TGACCGGTCAGCGGATCACC qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
2318305fw ATAATCACCTACGCGCCTTC qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2318305rv ACCTGCCTGCCTGAATAAAC qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2318305p TGCCGCAGATCACCCTGGTC qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2351285fw ACACATTGCCGAATATGCC qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2351285rv GTTAATGCGGTGATCCATGA qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2351285p CTGCGCATTCGCATGTTCCC qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2923803fw GTCAGCCACCTGCTGAAAT qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2923803rv ATACTGAATTTGGAGCGAACC qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2923803p TGCCTGATCACCCATCAACCAGA qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2952960fw CTACTGTTTCGCGGATCTCA qPCR for recD-region on E. coli chromosome with many GATC-sites 8
2952960rv CAACTGCTTGCAGAACCATT qPCR for recD-region on E. coli chromosome with many GATC-sites 8
2952960p CTGGTGATCACCCGCGCATT qPCR for recD-region on E. coli chromosome with many GATC-sites 8
3923874fw GCCCTGTGGATAACAAGGAT qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3923874rv CCTCATTCTGATCCCAGCTT qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3923874p CGGTCCAGGATCACCGATCATTC qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3921366fw GAGAATATGGCGTACCAGCA qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
3921366rv AAGACGCAGGTATTTCGCTT qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
3921366p CAACCTGACTTCGGTCCGCG qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
4301774fw CTGAATAACTCGCCTCGTGA qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4301774rv ATTCCCGTCTTCATGGTTTC qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4301774p TAAGCGCCGATCACCGGGAT qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4321507fw AGCCAGAGGTGGAGTTAGGA qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
4321507rv ACAACCTGAACGATCTGCTG qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
4321507p TCTCACCTTTGGCAATGGCGA qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
ter-fw TCCTCGCTGTTTGTCATCTT qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17
ter-rv GGTCTTGCTCGAATCCCTT qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17
ter-p CATCAGCACCCACGCAGCAA qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17


  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935. PubMed HubMed [Yamazoe-2005]
Personal tools