User:Torsten Waldminghaus/qPCR-Primers: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
No edit summary |
||
Line 49: | Line 49: | ||
!761139p | !761139p | ||
|CCAGGAAGCCCACGGATTCG | |CCAGGAAGCCCACGGATTCG | ||
| | |qPCR for sucB-region on E. coli chromosome with many GATC-sites | ||
|6 | |6 | ||
|- | |- | ||
!761139fw | !761139fw | ||
|GAGATCCTGCCGATGATGTA | |GAGATCCTGCCGATGATGTA | ||
| | |qPCR for sucB-region on E. coli chromosome with many GATC-sites | ||
|6 | |6 | ||
|- | |- | ||
!761139rv | !761139rv | ||
|TTCCAGCAACTCTTTGATCG | |TTCCAGCAACTCTTTGATCG | ||
| | |qPCR for sucB-region on E. coli chromosome with many GATC-sites | ||
|6 | |6 | ||
|- | |- | ||
!797735fw | !797735fw | ||
|CGTCCTGGCGTATCGTATC | |CGTCCTGGCGTATCGTATC | ||
| | |qPCR for pgl-region on E. coli chromosome with isolated GATC-site | ||
|4 | |4 | ||
|- | |- | ||
!797735rv | !797735rv | ||
|GCATTGTAAGAACCTACAAAGACAA | |GCATTGTAAGAACCTACAAAGACAA | ||
| | |qPCR for pgl-region on E. coli chromosome with isolated GATC-site | ||
|4 | |4 | ||
|- | |- | ||
!797735p | !797735p | ||
|TTTGCCGCAGAGTCTGCGCT | |TTTGCCGCAGAGTCTGCGCT | ||
| | |qPCR for pgl-region on E. coli chromosome with isolated GATC-site | ||
|4 | |4 | ||
|- | |- | ||
!1504230fw | !1504230fw | ||
|CGCCTTCAGTTTATGATCCA | |CGCCTTCAGTTTATGATCCA | ||
| | |qPCR for ydcN-region on E. coli chromosome with many GATC-sites | ||
|13 | |13 | ||
|- | |- | ||
!1504230rv | !1504230rv | ||
|TCGAGAAGTGTTCAAAGCAGA | |TCGAGAAGTGTTCAAAGCAGA | ||
| | |qPCR for ydcN-region on E. coli chromosome with many GATC-sites | ||
|13 | |13 | ||
|- | |- | ||
!1504230p | !1504230p | ||
|TGATCACCATCGCCTGCTGTTG | |TGATCACCATCGCCTGCTGTTG | ||
| | |qPCR for ydcN-region on E. coli chromosome with many GATC-sites | ||
|13 | |13 | ||
|- | |- | ||
!1514191fw | !1514191fw | ||
|ATACTGTTTGGCAGAGGCAA | |ATACTGTTTGGCAGAGGCAA | ||
| | |qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | ||
|12 | |12 | ||
|- | |- | ||
!1514191rv | !1514191rv | ||
|GGTATGGCTGATGATGTGCT | |GGTATGGCTGATGATGTGCT | ||
| | |qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | ||
|12 | |12 | ||
|- | |- | ||
!1514191p | !1514191p | ||
|TGACCGGTCAGCGGATCACC | |TGACCGGTCAGCGGATCACC | ||
| | |qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | ||
|12 | |12 | ||
|- | |- | ||
!2318305fw | !2318305fw | ||
|ATAATCACCTACGCGCCTTC | |ATAATCACCTACGCGCCTTC | ||
| | |qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | ||
|5 | |5 | ||
|- | |- | ||
!2318305rv | !2318305rv | ||
|ACCTGCCTGCCTGAATAAAC | |ACCTGCCTGCCTGAATAAAC | ||
| | |qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | ||
|5 | |5 | ||
|- | |- | ||
!2318305p | !2318305p | ||
|TGCCGCAGATCACCCTGGTC | |TGCCGCAGATCACCCTGGTC | ||
| | |qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | ||
|5 | |5 | ||
|- | |- | ||
!2351285fw | !2351285fw | ||
|ACACATTGCCGAATATGCC | |ACACATTGCCGAATATGCC | ||
| | |qPCR for glpAB-region on E. coli chromosome with many GATC-sites | ||
|16 | |16 | ||
|- | |- | ||
!2351285rv | !2351285rv | ||
|GTTAATGCGGTGATCCATGA | |GTTAATGCGGTGATCCATGA | ||
| | |qPCR for glpAB-region on E. coli chromosome with many GATC-sites | ||
|16 | |16 | ||
|- | |- | ||
!2351285p | !2351285p | ||
|CTGCGCATTCGCATGTTCCC | |CTGCGCATTCGCATGTTCCC | ||
| | |qPCR for glpAB-region on E. coli chromosome with many GATC-sites | ||
|16 | |16 | ||
|- | |- | ||
!2923803fw | !2923803fw | ||
|GTCAGCCACCTGCTGAAAT | |GTCAGCCACCTGCTGAAAT | ||
| | |qPCR for queF-region on E. coli chromosome with isolated GATC-site | ||
|15 | |15 | ||
|- | |- | ||
!2923803rv | !2923803rv | ||
|ATACTGAATTTGGAGCGAACC | |ATACTGAATTTGGAGCGAACC | ||
| | |qPCR for queF-region on E. coli chromosome with isolated GATC-site | ||
|15 | |15 | ||
|- | |- | ||
!2923803p | !2923803p | ||
|TGCCTGATCACCCATCAACCAGA | |TGCCTGATCACCCATCAACCAGA | ||
| | |qPCR for queF-region on E. coli chromosome with isolated GATC-site | ||
|15 | |15 | ||
|- | |- | ||
!2952960fw | !2952960fw | ||
|CTACTGTTTCGCGGATCTCA | |CTACTGTTTCGCGGATCTCA | ||
| | |qPCR for recD-region on E. coli chromosome with many GATC-sites | ||
|8 | |8 | ||
|- | |- | ||
!2952960rv | !2952960rv | ||
|CAACTGCTTGCAGAACCATT | |CAACTGCTTGCAGAACCATT | ||
| | |qPCR for recD-region on E. coli chromosome with many GATC-sites | ||
|8 | |8 | ||
|- | |- | ||
!2952960p | !2952960p | ||
|CTGGTGATCACCCGCGCATT | |CTGGTGATCACCCGCGCATT | ||
| | |qPCR for recD-region on E. coli chromosome with many GATC-sites | ||
|8 | |8 | ||
|- | |- | ||
!3923874fw | !3923874fw | ||
|GCCCTGTGGATAACAAGGAT | |GCCCTGTGGATAACAAGGAT | ||
| | |qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites | ||
|18 | |18 | ||
|- | |- | ||
!3923874rv | !3923874rv | ||
|CCTCATTCTGATCCCAGCTT | |CCTCATTCTGATCCCAGCTT | ||
| | |qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites | ||
|18 | |18 | ||
|- | |- | ||
!3923874p | !3923874p | ||
|CGGTCCAGGATCACCGATCATTC | |CGGTCCAGGATCACCGATCATTC | ||
| | |qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites | ||
|18 | |18 | ||
|- | |- | ||
!3921366fw | !3921366fw | ||
|GAGAATATGGCGTACCAGCA | |GAGAATATGGCGTACCAGCA | ||
| | |qPCR for gidB-region on E. coli chromosome with isolated GATC-site | ||
|7 | |7 | ||
|- | |- | ||
!3921366rv | !3921366rv | ||
|AAGACGCAGGTATTTCGCTT | |AAGACGCAGGTATTTCGCTT | ||
| | |qPCR for gidB-region on E. coli chromosome with isolated GATC-site | ||
|7 | |7 | ||
|- | |- | ||
!3921366p | !3921366p | ||
|CAACCTGACTTCGGTCCGCG | |CAACCTGACTTCGGTCCGCG | ||
| | |qPCR for gidB-region on E. coli chromosome with isolated GATC-site | ||
|7 | |7 | ||
|- | |- | ||
!4301774fw | !4301774fw | ||
|CTGAATAACTCGCCTCGTGA | |CTGAATAACTCGCCTCGTGA | ||
| | |qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | ||
|10 | |10 | ||
|- | |- | ||
!4301774rv | !4301774rv | ||
|ATTCCCGTCTTCATGGTTTC | |ATTCCCGTCTTCATGGTTTC | ||
| | |qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | ||
|10 | |10 | ||
|- | |- | ||
!4301774p | !4301774p | ||
|TAAGCGCCGATCACCGGGAT | |TAAGCGCCGATCACCGGGAT | ||
| | |qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | ||
|10 | |10 | ||
|- | |- | ||
!4321507fw | !4321507fw | ||
|AGCCAGAGGTGGAGTTAGGA | |AGCCAGAGGTGGAGTTAGGA | ||
| | |qPCR for phnD-region on E. coli chromosome with many GATC-sites | ||
|9 | |9 | ||
|- | |- | ||
!4321507rv | !4321507rv | ||
|ACAACCTGAACGATCTGCTG | |ACAACCTGAACGATCTGCTG | ||
| | |qPCR for phnD-region on E. coli chromosome with many GATC-sites | ||
|9 | |9 | ||
|- | |- | ||
!4321507p | !4321507p | ||
|TCTCACCTTTGGCAATGGCGA | |TCTCACCTTTGGCAATGGCGA | ||
| | |qPCR for phnD-region on E. coli chromosome with many GATC-sites | ||
|9 | |9 | ||
|- | |- | ||
!ter-fw | !ter-fw | ||
|TCCTCGCTGTTTGTCATCTT | |TCCTCGCTGTTTGTCATCTT | ||
| | |qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | ||
|17 | |17 | ||
|- | |- | ||
!ter-rv | !ter-rv | ||
|GGTCTTGCTCGAATCCCTT | |GGTCTTGCTCGAATCCCTT | ||
| | |qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | ||
|17 | |17 | ||
|- | |- | ||
!ter-p | !ter-p | ||
|CATCAGCACCCACGCAGCAA | |CATCAGCACCCACGCAGCAA | ||
| | |qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | ||
|17 | |17 | ||
|- | |- |
Revision as of 03:21, 16 December 2008
Name | Sequence | Characteristics | Probe set number |
---|---|---|---|
uvrDfw | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) | 1 |
uvrDrv | GTCAGCGTCAGTTTCTGCAT | qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) | 1 |
uvrDprobe | AGACGCCCGCCTTCATCCAG | HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1] | 1 |
yahEFfw | CCATCGAGACGATCAAAGAA | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
yahEFrv | CAGCATCTGGCTTTGTTGTT | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
yahEFprobe | AACTCGCGTCCTTCGGCAGC | HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
cluster-fw | CTGACTGATGAGATCCAACGA | qPCR for GATC-cluster | 14 |
cluster-rv | CTGGTGCTACGCCTGAATAA | qPCR for GATC-cluster | 14 |
cluster-p | AAATTCGACCCGGCTGTCGC | qPCR for GATC-cluster | 14 |
761139p | CCAGGAAGCCCACGGATTCG | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
761139fw | GAGATCCTGCCGATGATGTA | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
761139rv | TTCCAGCAACTCTTTGATCG | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
797735fw | CGTCCTGGCGTATCGTATC | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
797735rv | GCATTGTAAGAACCTACAAAGACAA | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
797735p | TTTGCCGCAGAGTCTGCGCT | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
1504230fw | CGCCTTCAGTTTATGATCCA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
1504230rv | TCGAGAAGTGTTCAAAGCAGA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
1504230p | TGATCACCATCGCCTGCTGTTG | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
1514191fw | ATACTGTTTGGCAGAGGCAA | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
1514191rv | GGTATGGCTGATGATGTGCT | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
1514191p | TGACCGGTCAGCGGATCACC | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
2318305fw | ATAATCACCTACGCGCCTTC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
2318305rv | ACCTGCCTGCCTGAATAAAC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
2318305p | TGCCGCAGATCACCCTGGTC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
2351285fw | ACACATTGCCGAATATGCC | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
2351285rv | GTTAATGCGGTGATCCATGA | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
2351285p | CTGCGCATTCGCATGTTCCC | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
2923803fw | GTCAGCCACCTGCTGAAAT | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
2923803rv | ATACTGAATTTGGAGCGAACC | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
2923803p | TGCCTGATCACCCATCAACCAGA | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
2952960fw | CTACTGTTTCGCGGATCTCA | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
2952960rv | CAACTGCTTGCAGAACCATT | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
2952960p | CTGGTGATCACCCGCGCATT | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
3923874fw | GCCCTGTGGATAACAAGGAT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
3923874rv | CCTCATTCTGATCCCAGCTT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
3923874p | CGGTCCAGGATCACCGATCATTC | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
3921366fw | GAGAATATGGCGTACCAGCA | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
3921366rv | AAGACGCAGGTATTTCGCTT | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
3921366p | CAACCTGACTTCGGTCCGCG | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
4301774fw | CTGAATAACTCGCCTCGTGA | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
4301774rv | ATTCCCGTCTTCATGGTTTC | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
4301774p | TAAGCGCCGATCACCGGGAT | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
4321507fw | AGCCAGAGGTGGAGTTAGGA | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
4321507rv | ACAACCTGAACGATCTGCTG | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
4321507p | TCTCACCTTTGGCAATGGCGA | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
ter-fw | TCCTCGCTGTTTGTCATCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
ter-rv | GGTCTTGCTCGAATCCCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
ter-p | CATCAGCACCCACGCAGCAA | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |