User:Torsten Waldminghaus/qPCR-Primers
From OpenWetWare
(Difference between revisions)
| Line 1: | Line 1: | ||
| + | *All primers are in concentrations of 100pmol/μL | ||
| + | |||
{| border="3" | {| border="3" | ||
! Name !! Sequence !! Characteristics !!Probe set number | ! Name !! Sequence !! Characteristics !!Probe set number | ||
| Line 44: | Line 46: | ||
!cluster-p | !cluster-p | ||
|AAATTCGACCCGGCTGTCGC | |AAATTCGACCCGGCTGTCGC | ||
| - | |qPCR for GATC-cluster | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster |
|14 | |14 | ||
|- | |- | ||
!761139p | !761139p | ||
|CCAGGAAGCCCACGGATTCG | |CCAGGAAGCCCACGGATTCG | ||
| - | |qPCR for sucB-region on E. coli chromosome with many GATC-sites | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites |
|6 | |6 | ||
|- | |- | ||
| Line 74: | Line 76: | ||
!797735p | !797735p | ||
|TTTGCCGCAGAGTCTGCGCT | |TTTGCCGCAGAGTCTGCGCT | ||
| - | |qPCR for pgl-region on E. coli chromosome with isolated GATC-site | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site |
|4 | |4 | ||
|- | |- | ||
| Line 89: | Line 91: | ||
!1504230p | !1504230p | ||
|TGATCACCATCGCCTGCTGTTG | |TGATCACCATCGCCTGCTGTTG | ||
| - | |qPCR for ydcN-region on E. coli chromosome with many GATC-sites | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites |
|13 | |13 | ||
|- | |- | ||
| Line 104: | Line 106: | ||
!1514191p | !1514191p | ||
|TGACCGGTCAGCGGATCACC | |TGACCGGTCAGCGGATCACC | ||
| - | |qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site |
|12 | |12 | ||
|- | |- | ||
| Line 119: | Line 121: | ||
!2318305p | !2318305p | ||
|TGCCGCAGATCACCCTGGTC | |TGCCGCAGATCACCCTGGTC | ||
| - | |qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site |
|5 | |5 | ||
|- | |- | ||
| Line 134: | Line 136: | ||
!2351285p | !2351285p | ||
|CTGCGCATTCGCATGTTCCC | |CTGCGCATTCGCATGTTCCC | ||
| - | |qPCR for glpAB-region on E. coli chromosome with many GATC-sites | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites |
|16 | |16 | ||
|- | |- | ||
| Line 149: | Line 151: | ||
!2923803p | !2923803p | ||
|TGCCTGATCACCCATCAACCAGA | |TGCCTGATCACCCATCAACCAGA | ||
| - | |qPCR for queF-region on E. coli chromosome with isolated GATC-site | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site |
|15 | |15 | ||
|- | |- | ||
| Line 164: | Line 166: | ||
!2952960p | !2952960p | ||
|CTGGTGATCACCCGCGCATT | |CTGGTGATCACCCGCGCATT | ||
| - | |qPCR for recD-region on E. coli chromosome with many GATC-sites | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites |
|8 | |8 | ||
|- | |- | ||
| Line 179: | Line 181: | ||
!3923874p | !3923874p | ||
|CGGTCCAGGATCACCGATCATTC | |CGGTCCAGGATCACCGATCATTC | ||
| - | |qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites |
|18 | |18 | ||
|- | |- | ||
| Line 194: | Line 196: | ||
!3921366p | !3921366p | ||
|CAACCTGACTTCGGTCCGCG | |CAACCTGACTTCGGTCCGCG | ||
| - | |qPCR for gidB-region on E. coli chromosome with isolated GATC-site | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site |
|7 | |7 | ||
|- | |- | ||
| Line 209: | Line 211: | ||
!4301774p | !4301774p | ||
|TAAGCGCCGATCACCGGGAT | |TAAGCGCCGATCACCGGGAT | ||
| - | |qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site |
|10 | |10 | ||
|- | |- | ||
| Line 224: | Line 226: | ||
!4321507p | !4321507p | ||
|TCTCACCTTTGGCAATGGCGA | |TCTCACCTTTGGCAATGGCGA | ||
| - | |qPCR for phnD-region on E. coli chromosome with many GATC-sites | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites |
|9 | |9 | ||
|- | |- | ||
| Line 239: | Line 241: | ||
!ter-p | !ter-p | ||
|CATCAGCACCCACGCAGCAA | |CATCAGCACCCACGCAGCAA | ||
| - | |qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site |
|17 | |17 | ||
|- | |- | ||
Revision as of 06:24, 16 December 2008
- All primers are in concentrations of 100pmol/μL
| Name | Sequence | Characteristics | Probe set number |
|---|---|---|---|
| uvrDfw | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) | 1 |
| uvrDrv | GTCAGCGTCAGTTTCTGCAT | qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) | 1 |
| uvrDprobe | AGACGCCCGCCTTCATCCAG | HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1] | 1 |
| yahEFfw | CCATCGAGACGATCAAAGAA | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
| yahEFrv | CAGCATCTGGCTTTGTTGTT | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
| yahEFprobe | AACTCGCGTCCTTCGGCAGC | HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
| cluster-fw | CTGACTGATGAGATCCAACGA | qPCR for GATC-cluster | 14 |
| cluster-rv | CTGGTGCTACGCCTGAATAA | qPCR for GATC-cluster | 14 |
| cluster-p | AAATTCGACCCGGCTGTCGC | HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster | 14 |
| 761139p | CCAGGAAGCCCACGGATTCG | HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 761139fw | GAGATCCTGCCGATGATGTA | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 761139rv | TTCCAGCAACTCTTTGATCG | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 797735fw | CGTCCTGGCGTATCGTATC | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 797735rv | GCATTGTAAGAACCTACAAAGACAA | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 797735p | TTTGCCGCAGAGTCTGCGCT | HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 1504230fw | CGCCTTCAGTTTATGATCCA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1504230rv | TCGAGAAGTGTTCAAAGCAGA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1504230p | TGATCACCATCGCCTGCTGTTG | HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1514191fw | ATACTGTTTGGCAGAGGCAA | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 1514191rv | GGTATGGCTGATGATGTGCT | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 1514191p | TGACCGGTCAGCGGATCACC | HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 2318305fw | ATAATCACCTACGCGCCTTC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2318305rv | ACCTGCCTGCCTGAATAAAC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2318305p | TGCCGCAGATCACCCTGGTC | HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2351285fw | ACACATTGCCGAATATGCC | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2351285rv | GTTAATGCGGTGATCCATGA | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2351285p | CTGCGCATTCGCATGTTCCC | HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2923803fw | GTCAGCCACCTGCTGAAAT | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2923803rv | ATACTGAATTTGGAGCGAACC | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2923803p | TGCCTGATCACCCATCAACCAGA | HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2952960fw | CTACTGTTTCGCGGATCTCA | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 2952960rv | CAACTGCTTGCAGAACCATT | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 2952960p | CTGGTGATCACCCGCGCATT | HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 3923874fw | GCCCTGTGGATAACAAGGAT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3923874rv | CCTCATTCTGATCCCAGCTT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3923874p | CGGTCCAGGATCACCGATCATTC | HPLC-pure 5'Fam - 3'Tamra qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3921366fw | GAGAATATGGCGTACCAGCA | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 3921366rv | AAGACGCAGGTATTTCGCTT | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 3921366p | CAACCTGACTTCGGTCCGCG | HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 4301774fw | CTGAATAACTCGCCTCGTGA | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4301774rv | ATTCCCGTCTTCATGGTTTC | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4301774p | TAAGCGCCGATCACCGGGAT | HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4321507fw | AGCCAGAGGTGGAGTTAGGA | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| 4321507rv | ACAACCTGAACGATCTGCTG | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| 4321507p | TCTCACCTTTGGCAATGGCGA | HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| ter-fw | TCCTCGCTGTTTGTCATCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
| ter-rv | GGTCTTGCTCGAATCCCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
| ter-p | CATCAGCACCCACGCAGCAA | HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
- Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935.
