User:Torsten Waldminghaus/qPCR-Primers

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
 +
*All primers are in concentrations of 100pmol/μL
 +
{| border="3"
{| border="3"
! Name !! Sequence !! Characteristics !!Probe set number
! Name !! Sequence !! Characteristics !!Probe set number
Line 44: Line 46:
!cluster-p
!cluster-p
|AAATTCGACCCGGCTGTCGC
|AAATTCGACCCGGCTGTCGC
-
|qPCR for GATC-cluster  
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster  
|14
|14
|-
|-
!761139p
!761139p
|CCAGGAAGCCCACGGATTCG
|CCAGGAAGCCCACGGATTCG
-
|qPCR for sucB-region on E. coli chromosome with many GATC-sites
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites
|6
|6
|-
|-
Line 74: Line 76:
!797735p
!797735p
|TTTGCCGCAGAGTCTGCGCT
|TTTGCCGCAGAGTCTGCGCT
-
|qPCR for pgl-region on E. coli chromosome with isolated GATC-site
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site
|4
|4
|-
|-
Line 89: Line 91:
!1504230p
!1504230p
|TGATCACCATCGCCTGCTGTTG
|TGATCACCATCGCCTGCTGTTG
-
|qPCR for ydcN-region on E. coli chromosome with many GATC-sites
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites
|13
|13
|-
|-
Line 104: Line 106:
!1514191p
!1514191p
|TGACCGGTCAGCGGATCACC
|TGACCGGTCAGCGGATCACC
-
|qPCR for ydcW-region on E. coli chromosome with isolated GATC-site
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site
|12
|12
|-
|-
Line 119: Line 121:
!2318305p
!2318305p
|TGCCGCAGATCACCCTGGTC
|TGCCGCAGATCACCCTGGTC
-
|qPCR for atoSC-region on E. coli chromosome with isolated GATC-site
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site
|5
|5
|-
|-
Line 134: Line 136:
!2351285p
!2351285p
|CTGCGCATTCGCATGTTCCC
|CTGCGCATTCGCATGTTCCC
-
|qPCR for glpAB-region on E. coli chromosome with many GATC-sites
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites
|16
|16
|-
|-
Line 149: Line 151:
!2923803p
!2923803p
|TGCCTGATCACCCATCAACCAGA
|TGCCTGATCACCCATCAACCAGA
-
|qPCR for queF-region on E. coli chromosome with isolated GATC-site
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site
|15
|15
|-
|-
Line 164: Line 166:
!2952960p
!2952960p
|CTGGTGATCACCCGCGCATT
|CTGGTGATCACCCGCGCATT
-
|qPCR for recD-region on E. coli chromosome with many GATC-sites
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites
|8
|8
|-
|-
Line 179: Line 181:
!3923874p
!3923874p
|CGGTCCAGGATCACCGATCATTC
|CGGTCCAGGATCACCGATCATTC
-
|qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites
|18
|18
|-
|-
Line 194: Line 196:
!3921366p
!3921366p
|CAACCTGACTTCGGTCCGCG
|CAACCTGACTTCGGTCCGCG
-
|qPCR for gidB-region on E. coli chromosome with isolated GATC-site
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site
|7
|7
|-
|-
Line 209: Line 211:
!4301774p
!4301774p
|TAAGCGCCGATCACCGGGAT
|TAAGCGCCGATCACCGGGAT
-
|qPCR for mdtO-region on E. coli chromosome with isolated GATC-site
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site
|10
|10
|-
|-
Line 224: Line 226:
!4321507p
!4321507p
|TCTCACCTTTGGCAATGGCGA
|TCTCACCTTTGGCAATGGCGA
-
|qPCR for phnD-region on E. coli chromosome with many GATC-sites
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites
|9
|9
|-
|-
Line 239: Line 241:
!ter-p
!ter-p
|CATCAGCACCCACGCAGCAA
|CATCAGCACCCACGCAGCAA
-
|qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site
+
|HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site
|17
|17
|-
|-

Revision as of 06:24, 16 December 2008

  • All primers are in concentrations of 100pmol/μL
Name Sequence Characteristics Probe set number
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) 1
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1] 1
yahEFfw CCATCGAGACGATCAAAGAA qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFrv CAGCATCTGGCTTTGTTGTT qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
yahEFprobe AACTCGCGTCCTTCGGCAGC HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
cluster-fw CTGACTGATGAGATCCAACGA qPCR for GATC-cluster 14
cluster-rv CTGGTGCTACGCCTGAATAA qPCR for GATC-cluster 14
cluster-p AAATTCGACCCGGCTGTCGC HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster 14
761139p CCAGGAAGCCCACGGATTCG HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
761139fw GAGATCCTGCCGATGATGTA qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
761139rv TTCCAGCAACTCTTTGATCG qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
797735fw CGTCCTGGCGTATCGTATC qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
797735rv GCATTGTAAGAACCTACAAAGACAA qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
797735p TTTGCCGCAGAGTCTGCGCT HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
1504230fw CGCCTTCAGTTTATGATCCA qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1504230rv TCGAGAAGTGTTCAAAGCAGA qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1504230p TGATCACCATCGCCTGCTGTTG HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1514191fw ATACTGTTTGGCAGAGGCAA qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
1514191rv GGTATGGCTGATGATGTGCT qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
1514191p TGACCGGTCAGCGGATCACC HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
2318305fw ATAATCACCTACGCGCCTTC qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2318305rv ACCTGCCTGCCTGAATAAAC qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2318305p TGCCGCAGATCACCCTGGTC HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2351285fw ACACATTGCCGAATATGCC qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2351285rv GTTAATGCGGTGATCCATGA qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2351285p CTGCGCATTCGCATGTTCCC HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2923803fw GTCAGCCACCTGCTGAAAT qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2923803rv ATACTGAATTTGGAGCGAACC qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2923803p TGCCTGATCACCCATCAACCAGA HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2952960fw CTACTGTTTCGCGGATCTCA qPCR for recD-region on E. coli chromosome with many GATC-sites 8
2952960rv CAACTGCTTGCAGAACCATT qPCR for recD-region on E. coli chromosome with many GATC-sites 8
2952960p CTGGTGATCACCCGCGCATT HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites 8
3923874fw GCCCTGTGGATAACAAGGAT qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3923874rv CCTCATTCTGATCCCAGCTT qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3923874p CGGTCCAGGATCACCGATCATTC HPLC-pure 5'Fam - 3'Tamra qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3921366fw GAGAATATGGCGTACCAGCA qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
3921366rv AAGACGCAGGTATTTCGCTT qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
3921366p CAACCTGACTTCGGTCCGCG HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
4301774fw CTGAATAACTCGCCTCGTGA qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4301774rv ATTCCCGTCTTCATGGTTTC qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4301774p TAAGCGCCGATCACCGGGAT HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4321507fw AGCCAGAGGTGGAGTTAGGA qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
4321507rv ACAACCTGAACGATCTGCTG qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
4321507p TCTCACCTTTGGCAATGGCGA HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
ter-fw TCCTCGCTGTTTGTCATCTT qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17
ter-rv GGTCTTGCTCGAATCCCTT qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17
ter-p CATCAGCACCCACGCAGCAA HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17


  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935. PubMed HubMed [Yamazoe-2005]
Personal tools