User:Torsten Waldminghaus/qPCR-Primers
From OpenWetWare
(Difference between revisions)
| Line 7: | Line 7: | ||
! uvrDfw | ! uvrDfw | ||
| AGTTCCCGCAGGTGTTTATC | | AGTTCCCGCAGGTGTTTATC | ||
| - | | qPCR for uvrD-region on E. coli | + | | qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)(region contains no HphI site so it can be used as control in methylation analysis) |
|1 | |1 | ||
|- | |- | ||
! uvrDrv | ! uvrDrv | ||
|GTCAGCGTCAGTTTCTGCAT | |GTCAGCGTCAGTTTCTGCAT | ||
| - | |qPCR for uvrD-region on E. coli | + | |qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)(region contains no HphI site so it can be used as control in methylation analysis) |
|1 | |1 | ||
|- | |- | ||
!uvrDprobe | !uvrDprobe | ||
|AGACGCCCGCCTTCATCCAG | |AGACGCCCGCCTTCATCCAG | ||
| - | |HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite> | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)(region contains no HphI site so it can be used as control in methylation analysis) |
|1 | |1 | ||
|- | |- | ||
Revision as of 07:17, 20 March 2009
- All primers are in concentrations of 100pmol/μL
- All Vibrio cholerae primers could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers
| Name | Sequence | Characteristics | Probe set number |
|---|---|---|---|
| uvrDfw | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) | 1 |
| uvrDrv | GTCAGCGTCAGTTTCTGCAT | qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) | 1 |
| uvrDprobe | AGACGCCCGCCTTCATCCAG | HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) | 1 |
| yahEFfw | CCATCGAGACGATCAAAGAA | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
| yahEFrv | CAGCATCTGGCTTTGTTGTT | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
| yahEFprobe | AACTCGCGTCCTTCGGCAGC | HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
| cluster-fw | CTGACTGATGAGATCCAACGA | qPCR for GATC-cluster | 14 |
| cluster-rv | CTGGTGCTACGCCTGAATAA | qPCR for GATC-cluster | 14 |
| cluster-p | AAATTCGACCCGGCTGTCGC | HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster | 14 |
| 761139p | CCAGGAAGCCCACGGATTCG | HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 761139fw | GAGATCCTGCCGATGATGTA | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 761139rv | TTCCAGCAACTCTTTGATCG | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 797735fw | CGTCCTGGCGTATCGTATC | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 797735rv | GCATTGTAAGAACCTACAAAGACAA | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 797735p | TTTGCCGCAGAGTCTGCGCT | HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 1504230fw | CGCCTTCAGTTTATGATCCA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1504230rv | TCGAGAAGTGTTCAAAGCAGA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1504230p | TGATCACCATCGCCTGCTGTTG | HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1514191fw | ATACTGTTTGGCAGAGGCAA | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 1514191rv | GGTATGGCTGATGATGTGCT | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 1514191p | TGACCGGTCAGCGGATCACC | HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 2318305fw | ATAATCACCTACGCGCCTTC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2318305rv | ACCTGCCTGCCTGAATAAAC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2318305p | TGCCGCAGATCACCCTGGTC | HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2351285fw | ACACATTGCCGAATATGCC | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2351285rv | GTTAATGCGGTGATCCATGA | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2351285p | CTGCGCATTCGCATGTTCCC | HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2923803fw | GTCAGCCACCTGCTGAAAT | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2923803rv | ATACTGAATTTGGAGCGAACC | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2923803p | TGCCTGATCACCCATCAACCAGA | HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2952960fw | CTACTGTTTCGCGGATCTCA | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 2952960rv | CAACTGCTTGCAGAACCATT | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 2952960p | CTGGTGATCACCCGCGCATT | HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 3923874fw | GCCCTGTGGATAACAAGGAT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3923874rv | CCTCATTCTGATCCCAGCTT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3923874p | CGGTCCAGGATCACCGATCATTC | HPLC-pure 5'Fam - 3'Tamra qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3921366fw | GAGAATATGGCGTACCAGCA | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 3921366rv | AAGACGCAGGTATTTCGCTT | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 3921366p | CAACCTGACTTCGGTCCGCG | HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 4301774fw | CTGAATAACTCGCCTCGTGA | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4301774rv | ATTCCCGTCTTCATGGTTTC | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4301774p | TAAGCGCCGATCACCGGGAT | HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4321507fw | AGCCAGAGGTGGAGTTAGGA | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| 4321507rv | ACAACCTGAACGATCTGCTG | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| 4321507p | TCTCACCTTTGGCAATGGCGA | HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| ter-fw | TCCTCGCTGTTTGTCATCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
| ter-rv | GGTCTTGCTCGAATCCCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
| ter-p | CATCAGCACCCACGCAGCAA | HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
| datA-fw | CAAGCTGTGGATGAATCAGG | qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 3 |
| datA-rv | AAATGCGTGCATAGTCGAAG | qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 3 |
| datA-p | CAATCACCCGAACCAGACGCTG | HPLC-pure 5'Fam - 3'Tamra qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 3 |
| ori1fw | AGATCAGCGTTGTCTTCACG | qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 19 |
| ori1rv | CCATGGGCACTAAAGAACCT | qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 19 |
| ori1Probe | TTCCGCACGCGAAGTGAACA | HPLC-pure 5'Fam - 3'Tamra qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 19 |
| ter1Rfw | GCTATGGTGGAAGCACAAGA | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 21 |
| ter1Rrv | CTCGTTCAAAGTCCGCTTG | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 21 |
| ter1Rprobe | TGCGCTTTCACACGCTGCTC | HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 21 |
| ori2fw | CCTTGAGCTTGAGATTGCTG | qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) | 20 |
| ori2rv | GCCGCCCTACTATCGTTAAA | qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) | 20 |
| ori2probe | TGCTCACGCTGAGCCTCATTCA | HPLC 5'Fam - 3'Tamra qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) | 20 |
| ter2Rfw | CCAAAGTGCAACCGACTAAA | qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) | 22 |
| ter2Rrv | ACGGCTAAACCAACCAGTTT | qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) | 22 |
| ter2Rprobe | TCGGCTCTGGCTCTTTCTTCTGC | HPLC 5'Fam - 3'Tamra qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) | 22 |
| ter1Cfw | CACATACACGCAAACCACAA | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) | 23 |
| ter1Crv | CTTACAGAAGCACGCCATTC | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) | 23 |
| ter1Cprobe | CCAGCCGCAATCTTGCCAAA | HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) | 23 |
| ter2Cfw | AGTTCGGTGAGATTGGCATT | qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) | 24 |
| ter2Crv | CGGTACTTCTTTGATCATCGC | qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) | 24 |
| ter2Cprobe | CCCTGCTCGCTCATGATGGC | HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) | 24 |
- Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935.
- Rasmussen T, Jensen RB, and Skovgaard O. . pmid:17557077.
- Srivastava P and Chattoraj DK. . pmid:17944831.
