User:Torsten Waldminghaus/qPCR-Primers

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
*All primers are in concentrations of 100pmol/μL
*All primers are in concentrations of 100pmol/μL
*All Vibrio cholerae primers could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers
{| border="3"
{| border="3"
Line 262: Line 261:
|qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961)
|qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961. Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)
Line 277: Line 276:
|qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>Rasmussen-2007</cite>(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961)
|qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>Rasmussen-2007</cite>(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)
Line 292: Line 291:
|qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961)
|qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)
Line 307: Line 306:
|qPCR for ter2-region on Vibrio cholerae chromosome 2 according to <cite>Rasmussen-2007</cite> (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 )
|qPCR for ter2-region on Vibrio cholerae chromosome 2 according to <cite>Rasmussen-2007</cite> (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)
Line 322: Line 321:
|qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>chattoray-2007</cite> (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961)
|qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>chattoray-2007</cite> (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)
Line 337: Line 336:
|qPCR for ter1-region on Vibrio cholerae chromosome 2 according to <cite>chattoray-2007</cite> (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961)
|qPCR for ter1-region on Vibrio cholerae chromosome 2 according to <cite>chattoray-2007</cite> (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)

Revision as of 05:09, 12 August 2011

  • All primers are in concentrations of 100pmol/μL
Name Sequence Characteristics Probe set number
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) 1
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) 1
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis); chrom. position at bp 337400 1
yahEFfw CCATCGAGACGATCAAAGAA qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]); chrom. position at bp 337400 2
yahEFrv CAGCATCTGGCTTTGTTGTT qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]); chrom. position at bp 337400 2
yahEFprobe AACTCGCGTCCTTCGGCAGC HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) 2
cluster-fw CTGACTGATGAGATCCAACGA qPCR for GATC-cluster 14
cluster-rv CTGGTGCTACGCCTGAATAA qPCR for GATC-cluster 14
cluster-p AAATTCGACCCGGCTGTCGC HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster 14
761139p CCAGGAAGCCCACGGATTCG HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
761139fw GAGATCCTGCCGATGATGTA qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
761139rv TTCCAGCAACTCTTTGATCG qPCR for sucB-region on E. coli chromosome with many GATC-sites 6
797735fw CGTCCTGGCGTATCGTATC qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
797735rv GCATTGTAAGAACCTACAAAGACAA qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
797735p TTTGCCGCAGAGTCTGCGCT HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site 4
1504230fw CGCCTTCAGTTTATGATCCA qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1504230rv TCGAGAAGTGTTCAAAGCAGA qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1504230p TGATCACCATCGCCTGCTGTTG HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites 13
1514191fw ATACTGTTTGGCAGAGGCAA qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
1514191rv GGTATGGCTGATGATGTGCT qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
1514191p TGACCGGTCAGCGGATCACC HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site 12
2318305fw ATAATCACCTACGCGCCTTC qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2318305rv ACCTGCCTGCCTGAATAAAC qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2318305p TGCCGCAGATCACCCTGGTC HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site 5
2351285fw ACACATTGCCGAATATGCC qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2351285rv GTTAATGCGGTGATCCATGA qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2351285p CTGCGCATTCGCATGTTCCC HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites 16
2923803fw GTCAGCCACCTGCTGAAAT qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2923803rv ATACTGAATTTGGAGCGAACC qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2923803p TGCCTGATCACCCATCAACCAGA HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site 15
2952960fw CTACTGTTTCGCGGATCTCA qPCR for recD-region on E. coli chromosome with many GATC-sites 8
2952960rv CAACTGCTTGCAGAACCATT qPCR for recD-region on E. coli chromosome with many GATC-sites 8
2952960p CTGGTGATCACCCGCGCATT HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites 8
3923874fw GCCCTGTGGATAACAAGGAT qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3923874rv CCTCATTCTGATCCCAGCTT qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3923874p CGGTCCAGGATCACCGATCATTC HPLC-pure 5'Fam - 3'Tamra qPCR for oriC-region on E. coli chromosome with many GATC-sites 18
3921366fw GAGAATATGGCGTACCAGCA qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
3921366rv AAGACGCAGGTATTTCGCTT qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
3921366p CAACCTGACTTCGGTCCGCG HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site 7
4301774fw CTGAATAACTCGCCTCGTGA qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4301774rv ATTCCCGTCTTCATGGTTTC qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4301774p TAAGCGCCGATCACCGGGAT HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site 10
4321507fw AGCCAGAGGTGGAGTTAGGA qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
4321507rv ACAACCTGAACGATCTGCTG qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
4321507p TCTCACCTTTGGCAATGGCGA HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites 9
ter-fw TCCTCGCTGTTTGTCATCTT qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17
ter-rv GGTCTTGCTCGAATCCCTT qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17
ter-p CATCAGCACCCACGCAGCAA HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site 17
datA-fw CAAGCTGTGGATGAATCAGG qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) 3
datA-rv AAATGCGTGCATAGTCGAAG qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) 3
datA-p CAATCACCCGAACCAGACGCTG HPLC-pure 5'Fam - 3'Tamra qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) 3
ori1fw AGATCAGCGTTGTCTTCACG qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961. Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) 19
ori1rv CCATGGGCACTAAAGAACCT qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) 19
ori1Probe TTCCGCACGCGAAGTGAACA HPLC-pure 5'Fam - 3'Tamra qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) 19
ter1Rfw GCTATGGTGGAAGCACAAGA qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) 21
ter1Rrv CTCGTTCAAAGTCCGCTTG qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) 21
ter1Rprobe TGCGCTTTCACACGCTGCTC HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) 21
ori2fw CCTTGAGCTTGAGATTGCTG qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) 20
ori2rv GCCGCCCTACTATCGTTAAA qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) 20
ori2probe TGCTCACGCTGAGCCTCATTCA HPLC 5'Fam - 3'Tamra qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) 20
ter2Rfw CCAAAGTGCAACCGACTAAA qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) 22
ter2Rrv ACGGCTAAACCAACCAGTTT qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) 22
ter2Rprobe TCGGCTCTGGCTCTTTCTTCTGC HPLC 5'Fam - 3'Tamra qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) 22
ter1Cfw CACATACACGCAAACCACAA qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) 23
ter1Crv CTTACAGAAGCACGCCATTC qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) 23
ter1Cprobe CCAGCCGCAATCTTGCCAAA HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) 23
ter2Cfw AGTTCGGTGAGATTGGCATT qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) 24
ter2Crv CGGTACTTCTTTGATCATCGC qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) 24
ter2Cprobe CCCTGCTCGCTCATGATGGC HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) 24
oriOpenfw CAACTTTGTCGGCTTGAGAA qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest 25
oriOpenrv TGATCCTTTCCAGGTTGTTG qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest 25
oriOpenprobe TCCACAGGGCAGTGCGATCC HPLC5'Fam - 3'Tamra qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest 25
2728013fw CGCAACCCTTATCCTTTGTT qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments 11
2728013rv TAAGGGCCATGATGACTTGA qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments 11
2728013probe CTCCTTTGAGTTCCCGGCCG HPLC5'Fam - 3'Tamra qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments 11
ibpAqPCRfw AGGTAGCCAGAACACCCATC qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP 27
ibpAqPCRrv AAGTCCGCTGATAAGGCTTG qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP 27
ibpAqPCRprobe CGCGTCCTCATCGGCTACGA HPLC5'Fam - 3'Tamra qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP 27
rpsDfw AAGTTGATGCTGGCAAGATG qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome 28
rpsDrv TAAAGCTCGACGATCAGGTG qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome 28
rpsDprobe TCAGAACGCTCCGGCTTACGC 5'Fam - 3'Tamra qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome 28
recNfw TTACGCCAGCCTCTTTACTG qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) 26
recNrv AGCTCACGAACGATAGCAAA qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) 26
recNprobe TTGGCACAACTGACCATCAGCAA 5'Fam - 3'Tamra qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) 26
ori1fw_new AATCCGTGGAGAAGATCTGG qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers 29
ori1rv_new CCATGCTGGTTGAGAATACG qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers 29
ori1probe_new TCTTCCGCACGACGTTTGGC 5'Fam - 3'Tamra qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers 29
ORIqPCRfw TTGATCCAAGCTTCCTGACA qPCR primer for analysis of oriC in E. coli 30
ORIqPCRrv GGCGAAACACTGAAGATCAA qPCR primer for analysis of oriC in E. coli 30
ORIqPCRprobe CCCAGCCATTCTTCTGCCGG 5'Fam - 3'Tamra qPCR primer for analysis of oriC in E. coli 30
AToriCir_fw TACGCACCTGTGGACAATCT qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91
AToriCir_rv AAGTGGCGTCTCTCGTCTTC qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91
AToriCir_p CCGTCTTATTCCAGTAATTCACAGGCG 5'Fam - 3'Tamra qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91
ATterCir_fw GATGGGTCAGCACATGATTG qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81
ATterCir_rv ACGCCATCCTGATCGAAG qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81
ATterCir_p CGACGCTCGCCTTCCGTTTC 5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81
ATterLin_fw ATGCTTCATGAGCTTTCGTG qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65
ATterLin_rv CAACGATACAGTTCCCGATG qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65
ATterLin_p TTCCAGCCATGTTGCGAGGC 5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65
AToriLin_fw GTACATTAACGCTGCTTCGG qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89
AToriLin_rv TTGCATTAACCATAGGAAGCC qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89
AToriLin_p CCGCCTTAAGCGAATCTTGCG 5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89

  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935. PubMed HubMed [Yamazoe-2005]
  2. Rasmussen T, Jensen RB, and Skovgaard O. . pmid:17557077. PubMed HubMed [Rasmussen-2007]
  3. Srivastava P and Chattoraj DK. . pmid:17944831. PubMed HubMed [chattoray-2007]
All Medline abstracts: PubMed HubMed
Personal tools