User:Torsten Waldminghaus/qPCR-Primers
From OpenWetWare
< User:Torsten Waldminghaus(Difference between revisions)
Current revision (09:26, 24 August 2011) (view source) |
|||
| (23 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| + | *All primers are in concentrations of 100pmol/μL | ||
| + | |||
{| border="3" | {| border="3" | ||
| - | ! Name !! Sequence !! Characteristics !! | + | ! Name !! Sequence !! Characteristics !!Probe set number |
|- | |- | ||
| - | ! | + | ! test |
| AGTTCCCGCAGGTGTTTATC | | AGTTCCCGCAGGTGTTTATC | ||
| - | | qPCR for uvrD-region on E. coli | + | | qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)(region contains no HphI site so it can be used as control in methylation analysis) |
| + | |1 | ||
|- | |- | ||
! uvrDrv | ! uvrDrv | ||
|GTCAGCGTCAGTTTCTGCAT | |GTCAGCGTCAGTTTCTGCAT | ||
| - | |qPCR for uvrD-region on E. coli | + | |qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)(region contains no HphI site so it can be used as control in methylation analysis) |
| + | |1 | ||
|- | |- | ||
!uvrDprobe | !uvrDprobe | ||
|AGACGCCCGCCTTCATCCAG | |AGACGCCCGCCTTCATCCAG | ||
| - | |HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite> | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)(region contains no HphI site so it can be used as control in methylation analysis); chrom. position at bp 337400 |
| + | |1 | ||
|- | |- | ||
! yahEFfw | ! yahEFfw | ||
| CCATCGAGACGATCAAAGAA | | CCATCGAGACGATCAAAGAA | ||
| - | | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>) | + | | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>); chrom. position at bp 337400 |
| + | |2 | ||
|- | |- | ||
! yahEFrv | ! yahEFrv | ||
| CAGCATCTGGCTTTGTTGTT | | CAGCATCTGGCTTTGTTGTT | ||
| - | | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>) | + | | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>); chrom. position at bp 337400 |
| + | |2 | ||
|- | |- | ||
! yahEFprobe | ! yahEFprobe | ||
| AACTCGCGTCCTTCGGCAGC | | AACTCGCGTCCTTCGGCAGC | ||
| HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>) | | HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>) | ||
| + | |2 | ||
|- | |- | ||
!cluster-fw | !cluster-fw | ||
|CTGACTGATGAGATCCAACGA | |CTGACTGATGAGATCCAACGA | ||
|qPCR for GATC-cluster | |qPCR for GATC-cluster | ||
| + | |14 | ||
| + | |- | ||
!cluster-rv | !cluster-rv | ||
|CTGGTGCTACGCCTGAATAA | |CTGGTGCTACGCCTGAATAA | ||
|qPCR for GATC-cluster | |qPCR for GATC-cluster | ||
| + | |14 | ||
| + | |- | ||
!cluster-p | !cluster-p | ||
|AAATTCGACCCGGCTGTCGC | |AAATTCGACCCGGCTGTCGC | ||
| - | |qPCR for GATC-cluster | + | |HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster |
| + | |14 | ||
| + | |- | ||
| + | !761139p | ||
| + | |CCAGGAAGCCCACGGATTCG | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites | ||
| + | |6 | ||
| + | |- | ||
| + | !761139fw | ||
| + | |GAGATCCTGCCGATGATGTA | ||
| + | |qPCR for sucB-region on E. coli chromosome with many GATC-sites | ||
| + | |6 | ||
| + | |- | ||
| + | !761139rv | ||
| + | |TTCCAGCAACTCTTTGATCG | ||
| + | |qPCR for sucB-region on E. coli chromosome with many GATC-sites | ||
| + | |6 | ||
| + | |- | ||
| + | !797735fw | ||
| + | |CGTCCTGGCGTATCGTATC | ||
| + | |qPCR for pgl-region on E. coli chromosome with isolated GATC-site | ||
| + | |4 | ||
| + | |- | ||
| + | !797735rv | ||
| + | |GCATTGTAAGAACCTACAAAGACAA | ||
| + | |qPCR for pgl-region on E. coli chromosome with isolated GATC-site | ||
| + | |4 | ||
| + | |- | ||
| + | !797735p | ||
| + | |TTTGCCGCAGAGTCTGCGCT | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site | ||
| + | |4 | ||
| + | |- | ||
| + | !1504230fw | ||
| + | |CGCCTTCAGTTTATGATCCA | ||
| + | |qPCR for ydcN-region on E. coli chromosome with many GATC-sites | ||
| + | |13 | ||
| + | |- | ||
| + | !1504230rv | ||
| + | |TCGAGAAGTGTTCAAAGCAGA | ||
| + | |qPCR for ydcN-region on E. coli chromosome with many GATC-sites | ||
| + | |13 | ||
| + | |- | ||
| + | !1504230p | ||
| + | |TGATCACCATCGCCTGCTGTTG | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites | ||
| + | |13 | ||
| + | |- | ||
| + | !1514191fw | ||
| + | |ATACTGTTTGGCAGAGGCAA | ||
| + | |qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | ||
| + | |12 | ||
| + | |- | ||
| + | !1514191rv | ||
| + | |GGTATGGCTGATGATGTGCT | ||
| + | |qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | ||
| + | |12 | ||
| + | |- | ||
| + | !1514191p | ||
| + | |TGACCGGTCAGCGGATCACC | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | ||
| + | |12 | ||
| + | |- | ||
| + | !2318305fw | ||
| + | |ATAATCACCTACGCGCCTTC | ||
| + | |qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | ||
| + | |5 | ||
| + | |- | ||
| + | !2318305rv | ||
| + | |ACCTGCCTGCCTGAATAAAC | ||
| + | |qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | ||
| + | |5 | ||
| + | |- | ||
| + | !2318305p | ||
| + | |TGCCGCAGATCACCCTGGTC | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | ||
| + | |5 | ||
| + | |- | ||
| + | !2351285fw | ||
| + | |ACACATTGCCGAATATGCC | ||
| + | |qPCR for glpAB-region on E. coli chromosome with many GATC-sites | ||
| + | |16 | ||
| + | |- | ||
| + | !2351285rv | ||
| + | |GTTAATGCGGTGATCCATGA | ||
| + | |qPCR for glpAB-region on E. coli chromosome with many GATC-sites | ||
| + | |16 | ||
| + | |- | ||
| + | !2351285p | ||
| + | |CTGCGCATTCGCATGTTCCC | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites | ||
| + | |16 | ||
| + | |- | ||
| + | !2923803fw | ||
| + | |GTCAGCCACCTGCTGAAAT | ||
| + | |qPCR for queF-region on E. coli chromosome with isolated GATC-site | ||
| + | |15 | ||
| + | |- | ||
| + | !2923803rv | ||
| + | |ATACTGAATTTGGAGCGAACC | ||
| + | |qPCR for queF-region on E. coli chromosome with isolated GATC-site | ||
| + | |15 | ||
| + | |- | ||
| + | !2923803p | ||
| + | |TGCCTGATCACCCATCAACCAGA | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site | ||
| + | |15 | ||
| + | |- | ||
| + | !2952960fw | ||
| + | |CTACTGTTTCGCGGATCTCA | ||
| + | |qPCR for recD-region on E. coli chromosome with many GATC-sites | ||
| + | |8 | ||
| + | |- | ||
| + | !2952960rv | ||
| + | |CAACTGCTTGCAGAACCATT | ||
| + | |qPCR for recD-region on E. coli chromosome with many GATC-sites | ||
| + | |8 | ||
| + | |- | ||
| + | !2952960p | ||
| + | |CTGGTGATCACCCGCGCATT | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites | ||
| + | |8 | ||
| + | |- | ||
| + | !3923874fw | ||
| + | |GCCCTGTGGATAACAAGGAT | ||
| + | |qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites | ||
| + | |18 | ||
| + | |- | ||
| + | !3923874rv | ||
| + | |CCTCATTCTGATCCCAGCTT | ||
| + | |qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites | ||
| + | |18 | ||
| + | |- | ||
| + | !3923874p | ||
| + | |CGGTCCAGGATCACCGATCATTC | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for '''oriC'''-region on E. coli chromosome with many GATC-sites | ||
| + | |18 | ||
| + | |- | ||
| + | !3921366fw | ||
| + | |GAGAATATGGCGTACCAGCA | ||
| + | |qPCR for gidB-region on E. coli chromosome with isolated GATC-site | ||
| + | |7 | ||
| + | |- | ||
| + | !3921366rv | ||
| + | |AAGACGCAGGTATTTCGCTT | ||
| + | |qPCR for gidB-region on E. coli chromosome with isolated GATC-site | ||
| + | |7 | ||
| + | |- | ||
| + | !3921366p | ||
| + | |CAACCTGACTTCGGTCCGCG | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site | ||
| + | |7 | ||
| + | |- | ||
| + | !4301774fw | ||
| + | |CTGAATAACTCGCCTCGTGA | ||
| + | |qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | ||
| + | |10 | ||
| + | |- | ||
| + | !4301774rv | ||
| + | |ATTCCCGTCTTCATGGTTTC | ||
| + | |qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | ||
| + | |10 | ||
| + | |- | ||
| + | !4301774p | ||
| + | |TAAGCGCCGATCACCGGGAT | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | ||
| + | |10 | ||
| + | |- | ||
| + | !4321507fw | ||
| + | |AGCCAGAGGTGGAGTTAGGA | ||
| + | |qPCR for phnD-region on E. coli chromosome with many GATC-sites | ||
| + | |9 | ||
| + | |- | ||
| + | !4321507rv | ||
| + | |ACAACCTGAACGATCTGCTG | ||
| + | |qPCR for phnD-region on E. coli chromosome with many GATC-sites | ||
| + | |9 | ||
| + | |- | ||
| + | !4321507p | ||
| + | |TCTCACCTTTGGCAATGGCGA | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites | ||
| + | |9 | ||
| + | |- | ||
| + | !ter-fw | ||
| + | |TCCTCGCTGTTTGTCATCTT | ||
| + | |qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | ||
| + | |17 | ||
| + | |- | ||
| + | !ter-rv | ||
| + | |GGTCTTGCTCGAATCCCTT | ||
| + | |qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | ||
| + | |17 | ||
| + | |- | ||
| + | !ter-p | ||
| + | |CATCAGCACCCACGCAGCAA | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | ||
| + | |17 | ||
| + | |- | ||
| + | !datA-fw | ||
| + | |CAAGCTGTGGATGAATCAGG | ||
| + | |qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | ||
| + | |3 | ||
| + | |- | ||
| + | !datA-rv | ||
| + | |AAATGCGTGCATAGTCGAAG | ||
| + | |qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | ||
| + | |3 | ||
| + | |- | ||
| + | !datA-p | ||
| + | |CAATCACCCGAACCAGACGCTG | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | ||
| + | |3 | ||
| + | |- | ||
| + | !ori1fw | ||
| + | |AGATCAGCGTTGTCTTCACG | ||
| + | |qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961. Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | ||
| + | |19 | ||
| + | |- | ||
| + | !ori1rv | ||
| + | |CCATGGGCACTAAAGAACCT | ||
| + | |qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | ||
| + | |19 | ||
| + | |- | ||
| + | !ori1Probe | ||
| + | |TTCCGCACGCGAAGTGAACA | ||
| + | |HPLC-pure 5'Fam - 3'Tamra qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | ||
| + | |19 | ||
| + | |- | ||
| + | !ter1Rfw | ||
| + | |GCTATGGTGGAAGCACAAGA | ||
| + | |qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>Rasmussen-2007</cite>(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | ||
| + | |21 | ||
| + | |- | ||
| + | !ter1Rrv | ||
| + | |CTCGTTCAAAGTCCGCTTG | ||
| + | |qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>Rasmussen-2007</cite>(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | ||
| + | |21 | ||
| + | |- | ||
| + | !ter1Rprobe | ||
| + | |TGCGCTTTCACACGCTGCTC | ||
| + | |HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>Rasmussen-2007</cite>(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | ||
| + | |21 | ||
| + | |- | ||
| + | !ori2fw | ||
| + | |CCTTGAGCTTGAGATTGCTG | ||
| + | |qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | ||
| + | |20 | ||
| + | |- | ||
| + | !ori2rv | ||
| + | |GCCGCCCTACTATCGTTAAA | ||
| + | |qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) | ||
| + | |20 | ||
| + | |- | ||
| + | !ori2probe | ||
| + | |TGCTCACGCTGAGCCTCATTCA | ||
| + | |HPLC 5'Fam - 3'Tamra qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) | ||
| + | |20 | ||
| + | |- | ||
| + | !ter2Rfw | ||
| + | |CCAAAGTGCAACCGACTAAA | ||
| + | |qPCR for ter2-region on Vibrio cholerae chromosome 2 according to <cite>Rasmussen-2007</cite> (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | ||
| + | |22 | ||
| + | |- | ||
| + | !ter2Rrv | ||
| + | |ACGGCTAAACCAACCAGTTT | ||
| + | |qPCR for ter2-region on Vibrio cholerae chromosome 2 according to <cite>Rasmussen-2007</cite> (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) | ||
| + | |22 | ||
| + | |- | ||
| + | !ter2Rprobe | ||
| + | |TCGGCTCTGGCTCTTTCTTCTGC | ||
| + | |HPLC 5'Fam - 3'Tamra qPCR for ter2-region on Vibrio cholerae chromosome 2 according to <cite>Rasmussen-2007</cite> (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) | ||
| + | |22 | ||
| + | |- | ||
| + | !ter1Cfw | ||
| + | |CACATACACGCAAACCACAA | ||
| + | |qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>chattoray-2007</cite> (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | ||
| + | |23 | ||
| + | |- | ||
| + | !ter1Crv | ||
| + | |CTTACAGAAGCACGCCATTC | ||
| + | |qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>chattoray-2007</cite> (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) | ||
| + | |23 | ||
| + | |- | ||
| + | !ter1Cprobe | ||
| + | |CCAGCCGCAATCTTGCCAAA | ||
| + | |HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>chattoray-2007</cite> (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) | ||
| + | |23 | ||
| + | |- | ||
| + | !ter2Cfw | ||
| + | |AGTTCGGTGAGATTGGCATT | ||
| + | |qPCR for ter1-region on Vibrio cholerae chromosome 2 according to <cite>chattoray-2007</cite> (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | ||
| + | |24 | ||
| + | |- | ||
| + | !ter2Crv | ||
| + | |CGGTACTTCTTTGATCATCGC | ||
| + | |qPCR for ter1-region on Vibrio cholerae chromosome 2 according to <cite>chattoray-2007</cite> (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) | ||
| + | |24 | ||
| + | |- | ||
| + | !ter2Cprobe | ||
| + | |CCCTGCTCGCTCATGATGGC | ||
| + | |HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 2 according to <cite>chattoray-2007</cite> (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) | ||
| + | |24 | ||
| + | |- | ||
| + | !oriOpenfw | ||
| + | |CAACTTTGTCGGCTTGAGAA | ||
| + | |qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest | ||
| + | |25 | ||
| + | |- | ||
| + | !oriOpenrv | ||
| + | |TGATCCTTTCCAGGTTGTTG | ||
| + | |qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest | ||
| + | |25 | ||
| + | |- | ||
| + | !oriOpenprobe | ||
| + | |TCCACAGGGCAGTGCGATCC | ||
| + | |HPLC5'Fam - 3'Tamra qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest | ||
| + | |25 | ||
| + | |- | ||
| + | !2728013fw | ||
| + | |CGCAACCCTTATCCTTTGTT | ||
| + | |qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments | ||
| + | |11 | ||
| + | |- | ||
| + | !2728013rv | ||
| + | |TAAGGGCCATGATGACTTGA | ||
| + | |qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments | ||
| + | |11 | ||
| + | |- | ||
| + | !2728013probe | ||
| + | |CTCCTTTGAGTTCCCGGCCG | ||
| + | |HPLC5'Fam - 3'Tamra qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments | ||
| + | |11 | ||
| + | |- | ||
| + | !ibpAqPCRfw | ||
| + | |AGGTAGCCAGAACACCCATC | ||
| + | |qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP | ||
| + | |27 | ||
| + | |- | ||
| + | !ibpAqPCRrv | ||
| + | |AAGTCCGCTGATAAGGCTTG | ||
| + | |qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP | ||
| + | |27 | ||
| + | |- | ||
| + | !ibpAqPCRprobe | ||
| + | |CGCGTCCTCATCGGCTACGA | ||
| + | |HPLC5'Fam - 3'Tamra qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP | ||
| + | |27 | ||
| + | |- | ||
| + | !rpsDfw | ||
| + | |AAGTTGATGCTGGCAAGATG | ||
| + | |qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome | ||
| + | |28 | ||
| + | |- | ||
| + | !rpsDrv | ||
| + | |TAAAGCTCGACGATCAGGTG | ||
| + | |qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome | ||
| + | |28 | ||
| + | |- | ||
| + | !rpsDprobe | ||
| + | |TCAGAACGCTCCGGCTTACGC | ||
| + | |5'Fam - 3'Tamra qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome | ||
| + | |28 | ||
| + | |- | ||
| + | !recNfw | ||
| + | |TTACGCCAGCCTCTTTACTG | ||
| + | |qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) | ||
| + | |26 | ||
| + | |- | ||
| + | !recNrv | ||
| + | |AGCTCACGAACGATAGCAAA | ||
| + | |qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) | ||
| + | |26 | ||
| + | |- | ||
| + | !recNprobe | ||
| + | |TTGGCACAACTGACCATCAGCAA | ||
| + | |5'Fam - 3'Tamra qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) | ||
| + | |26 | ||
| + | |- | ||
| + | !ori1fw_new | ||
| + | |AATCCGTGGAGAAGATCTGG | ||
| + | |qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers | ||
| + | |29 | ||
| + | |- | ||
| + | !ori1rv_new | ||
| + | |CCATGCTGGTTGAGAATACG | ||
| + | |qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers | ||
| + | |29 | ||
| + | |- | ||
| + | !ori1probe_new | ||
| + | |TCTTCCGCACGACGTTTGGC | ||
| + | |5'Fam - 3'Tamra qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers | ||
| + | |29 | ||
| + | |- | ||
| + | !ORIqPCRfw | ||
| + | |TTGATCCAAGCTTCCTGACA | ||
| + | |qPCR primer for analysis of oriC in E. coli | ||
| + | |30 | ||
| + | |- | ||
| + | !ORIqPCRrv | ||
| + | |GGCGAAACACTGAAGATCAA | ||
| + | |qPCR primer for analysis of oriC in E. coli | ||
| + | |30 | ||
| + | |- | ||
| + | !ORIqPCRprobe | ||
| + | |CCCAGCCATTCTTCTGCCGG | ||
| + | |5'Fam - 3'Tamra qPCR primer for analysis of oriC in E. coli | ||
| + | |30 | ||
| + | |- | ||
| + | !AToriCir_fw | ||
| + | |TACGCACCTGTGGACAATCT | ||
| + | |qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91 | ||
| + | |31 | ||
| + | |- | ||
| + | !AToriCir_rv | ||
| + | |AAGTGGCGTCTCTCGTCTTC | ||
| + | |qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91 | ||
| + | |31 | ||
| + | |- | ||
| + | !AToriCir_p | ||
| + | |CCGTCTTATTCCAGTAATTCACAGGCG | ||
| + | |5'Fam - 3'Tamra qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91 | ||
| + | |31 | ||
| + | |- | ||
| + | !ATterCir_fw | ||
| + | |GATGGGTCAGCACATGATTG | ||
| + | |qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81 | ||
| + | |32 | ||
| + | |- | ||
| + | !ATterCir_rv | ||
| + | |ACGCCATCCTGATCGAAG | ||
| + | |qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81 | ||
| + | |32 | ||
| + | |- | ||
| + | !ATterCir_p | ||
| + | |CGACGCTCGCCTTCCGTTTC | ||
| + | |5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81 | ||
| + | |32 | ||
| + | |- | ||
| + | !ATterLin_fw | ||
| + | |ATGCTTCATGAGCTTTCGTG | ||
| + | |qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65 | ||
| + | |33 | ||
| + | |- | ||
| + | !ATterLin_rv | ||
| + | |CAACGATACAGTTCCCGATG | ||
| + | |qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65 | ||
| + | |33 | ||
| + | |- | ||
| + | !ATterLin_p | ||
| + | |TTCCAGCCATGTTGCGAGGC | ||
| + | |5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65 | ||
| + | |33 | ||
| + | |- | ||
| + | !AToriLin_fw | ||
| + | |GTACATTAACGCTGCTTCGG | ||
| + | |qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89 | ||
| + | |34 | ||
| + | |- | ||
| + | !AToriLin_rv | ||
| + | |TTGCATTAACCATAGGAAGCC | ||
| + | |qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89 | ||
| + | |34 | ||
| + | |- | ||
| + | !AToriLin_p | ||
| + | |CCGCCTTAAGCGAATCTTGCG | ||
| + | |5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89 | ||
| + | |34 | ||
| + | |- | ||
| + | !c_qPCR_v2.1 | ||
| + | |AATGATACGGCGACCACCGAGATC | ||
| + | |qPCR primer for quantification of Illumina ChIP library <cite>quail-2008</cite> | ||
| + | |35 | ||
| + | |- | ||
| + | !PE_qPCR_v2.2 | ||
| + | |CAAGCAGAAGACGGCATACGAGATC | ||
| + | |qPCR primer for quantification of Illumina ChIP library <cite>quail-2008</cite> | ||
| + | |35 | ||
| + | |- | ||
| + | !DLP | ||
| + | |CCCTACACGACGCTCTTCCGATCT | ||
| + | |5'Fam 3'Tamra qPCR primer for quantification of Illumina ChIP library <cite>quail-2008</cite> | ||
| + | |35 | ||
| + | |- | ||
|} | |} | ||
| - | + | ||
| - | + | ||
<biblio> | <biblio> | ||
#Yamazoe-2005 pmid=15612935 | #Yamazoe-2005 pmid=15612935 | ||
| + | #Rasmussen-2007 pmid=17557077 | ||
| + | #chattoray-2007 pmid=17944831 | ||
| + | #quail-2008 pmid=19034268 | ||
</biblio> | </biblio> | ||
Current revision
- All primers are in concentrations of 100pmol/μL
| Name | Sequence | Characteristics | Probe set number |
|---|---|---|---|
| test | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) | 1 |
| uvrDrv | GTCAGCGTCAGTTTCTGCAT | qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis) | 1 |
| uvrDprobe | AGACGCCCGCCTTCATCCAG | HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1])(region contains no HphI site so it can be used as control in methylation analysis); chrom. position at bp 337400 | 1 |
| yahEFfw | CCATCGAGACGATCAAAGAA | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]); chrom. position at bp 337400 | 2 |
| yahEFrv | CAGCATCTGGCTTTGTTGTT | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]); chrom. position at bp 337400 | 2 |
| yahEFprobe | AACTCGCGTCCTTCGGCAGC | HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | 2 |
| cluster-fw | CTGACTGATGAGATCCAACGA | qPCR for GATC-cluster | 14 |
| cluster-rv | CTGGTGCTACGCCTGAATAA | qPCR for GATC-cluster | 14 |
| cluster-p | AAATTCGACCCGGCTGTCGC | HPLC-pure 5'Fam - 3'Tamra qPCR for GATC-cluster | 14 |
| 761139p | CCAGGAAGCCCACGGATTCG | HPLC-pure 5'Fam - 3'Tamra qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 761139fw | GAGATCCTGCCGATGATGTA | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 761139rv | TTCCAGCAACTCTTTGATCG | qPCR for sucB-region on E. coli chromosome with many GATC-sites | 6 |
| 797735fw | CGTCCTGGCGTATCGTATC | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 797735rv | GCATTGTAAGAACCTACAAAGACAA | qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 797735p | TTTGCCGCAGAGTCTGCGCT | HPLC-pure 5'Fam - 3'Tamra qPCR for pgl-region on E. coli chromosome with isolated GATC-site | 4 |
| 1504230fw | CGCCTTCAGTTTATGATCCA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1504230rv | TCGAGAAGTGTTCAAAGCAGA | qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1504230p | TGATCACCATCGCCTGCTGTTG | HPLC-pure 5'Fam - 3'Tamra qPCR for ydcN-region on E. coli chromosome with many GATC-sites | 13 |
| 1514191fw | ATACTGTTTGGCAGAGGCAA | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 1514191rv | GGTATGGCTGATGATGTGCT | qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 1514191p | TGACCGGTCAGCGGATCACC | HPLC-pure 5'Fam - 3'Tamra qPCR for ydcW-region on E. coli chromosome with isolated GATC-site | 12 |
| 2318305fw | ATAATCACCTACGCGCCTTC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2318305rv | ACCTGCCTGCCTGAATAAAC | qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2318305p | TGCCGCAGATCACCCTGGTC | HPLC-pure 5'Fam - 3'Tamra qPCR for atoSC-region on E. coli chromosome with isolated GATC-site | 5 |
| 2351285fw | ACACATTGCCGAATATGCC | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2351285rv | GTTAATGCGGTGATCCATGA | qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2351285p | CTGCGCATTCGCATGTTCCC | HPLC-pure 5'Fam - 3'Tamra qPCR for glpAB-region on E. coli chromosome with many GATC-sites | 16 |
| 2923803fw | GTCAGCCACCTGCTGAAAT | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2923803rv | ATACTGAATTTGGAGCGAACC | qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2923803p | TGCCTGATCACCCATCAACCAGA | HPLC-pure 5'Fam - 3'Tamra qPCR for queF-region on E. coli chromosome with isolated GATC-site | 15 |
| 2952960fw | CTACTGTTTCGCGGATCTCA | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 2952960rv | CAACTGCTTGCAGAACCATT | qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 2952960p | CTGGTGATCACCCGCGCATT | HPLC-pure 5'Fam - 3'Tamra qPCR for recD-region on E. coli chromosome with many GATC-sites | 8 |
| 3923874fw | GCCCTGTGGATAACAAGGAT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3923874rv | CCTCATTCTGATCCCAGCTT | qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3923874p | CGGTCCAGGATCACCGATCATTC | HPLC-pure 5'Fam - 3'Tamra qPCR for oriC-region on E. coli chromosome with many GATC-sites | 18 |
| 3921366fw | GAGAATATGGCGTACCAGCA | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 3921366rv | AAGACGCAGGTATTTCGCTT | qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 3921366p | CAACCTGACTTCGGTCCGCG | HPLC-pure 5'Fam - 3'Tamra qPCR for gidB-region on E. coli chromosome with isolated GATC-site | 7 |
| 4301774fw | CTGAATAACTCGCCTCGTGA | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4301774rv | ATTCCCGTCTTCATGGTTTC | qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4301774p | TAAGCGCCGATCACCGGGAT | HPLC-pure 5'Fam - 3'Tamra qPCR for mdtO-region on E. coli chromosome with isolated GATC-site | 10 |
| 4321507fw | AGCCAGAGGTGGAGTTAGGA | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| 4321507rv | ACAACCTGAACGATCTGCTG | qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| 4321507p | TCTCACCTTTGGCAATGGCGA | HPLC-pure 5'Fam - 3'Tamra qPCR for phnD-region on E. coli chromosome with many GATC-sites | 9 |
| ter-fw | TCCTCGCTGTTTGTCATCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
| ter-rv | GGTCTTGCTCGAATCCCTT | qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
| ter-p | CATCAGCACCCACGCAGCAA | HPLC-pure 5'Fam - 3'Tamra qPCR for ter-region (ydeE cds) on E. coli chromosome with isolated GATC-site | 17 |
| datA-fw | CAAGCTGTGGATGAATCAGG | qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 3 |
| datA-rv | AAATGCGTGCATAGTCGAAG | qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 3 |
| datA-p | CAATCACCCGAACCAGACGCTG | HPLC-pure 5'Fam - 3'Tamra qPCR for datA-region on E. coli chromosome (region contains HphI site that does not overlap GATC so it can be used as control in methylation analysis) | 3 |
| ori1fw | AGATCAGCGTTGTCTTCACG | qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961. Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 19 |
| ori1rv | CCATGGGCACTAAAGAACCT | qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 19 |
| ori1Probe | TTCCGCACGCGAAGTGAACA | HPLC-pure 5'Fam - 3'Tamra qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 19 |
| ter1Rfw | GCTATGGTGGAAGCACAAGA | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 21 |
| ter1Rrv | CTCGTTCAAAGTCCGCTTG | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 21 |
| ter1Rprobe | TGCGCTTTCACACGCTGCTC | HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [2](region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961) | 21 |
| ori2fw | CCTTGAGCTTGAGATTGCTG | qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 20 |
| ori2rv | GCCGCCCTACTATCGTTAAA | qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) | 20 |
| ori2probe | TGCTCACGCTGAGCCTCATTCA | HPLC 5'Fam - 3'Tamra qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961) | 20 |
| ter2Rfw | CCAAAGTGCAACCGACTAAA | qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 22 |
| ter2Rrv | ACGGCTAAACCAACCAGTTT | qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) | 22 |
| ter2Rprobe | TCGGCTCTGGCTCTTTCTTCTGC | HPLC 5'Fam - 3'Tamra qPCR for ter2-region on Vibrio cholerae chromosome 2 according to [2] (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ) | 22 |
| ter1Cfw | CACATACACGCAAACCACAA | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 23 |
| ter1Crv | CTTACAGAAGCACGCCATTC | qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) | 23 |
| ter1Cprobe | CCAGCCGCAATCTTGCCAAA | HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 1 according to [3] (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961) | 23 |
| ter2Cfw | AGTTCGGTGAGATTGGCATT | qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers) | 24 |
| ter2Crv | CGGTACTTCTTTGATCATCGC | qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) | 24 |
| ter2Cprobe | CCCTGCTCGCTCATGATGGC | HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 2 according to [3] (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961) | 24 |
| oriOpenfw | CAACTTTGTCGGCTTGAGAA | qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest | 25 |
| oriOpenrv | TGATCCTTTCCAGGTTGTTG | qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest | 25 |
| oriOpenprobe | TCCACAGGGCAGTGCGATCC | HPLC5'Fam - 3'Tamra qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest | 25 |
| 2728013fw | CGCAACCCTTATCCTTTGTT | qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments | 11 |
| 2728013rv | TAAGGGCCATGATGACTTGA | qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments | 11 |
| 2728013probe | CTCCTTTGAGTTCCCGGCCG | HPLC5'Fam - 3'Tamra qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments | 11 |
| ibpAqPCRfw | AGGTAGCCAGAACACCCATC | qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP | 27 |
| ibpAqPCRrv | AAGTCCGCTGATAAGGCTTG | qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP | 27 |
| ibpAqPCRprobe | CGCGTCCTCATCGGCTACGA | HPLC5'Fam - 3'Tamra qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP | 27 |
| rpsDfw | AAGTTGATGCTGGCAAGATG | qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome | 28 |
| rpsDrv | TAAAGCTCGACGATCAGGTG | qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome | 28 |
| rpsDprobe | TCAGAACGCTCCGGCTTACGC | 5'Fam - 3'Tamra qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome | 28 |
| recNfw | TTACGCCAGCCTCTTTACTG | qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) | 26 |
| recNrv | AGCTCACGAACGATAGCAAA | qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) | 26 |
| recNprobe | TTGGCACAACTGACCATCAGCAA | 5'Fam - 3'Tamra qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites) | 26 |
| ori1fw_new | AATCCGTGGAGAAGATCTGG | qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers | 29 |
| ori1rv_new | CCATGCTGGTTGAGAATACG | qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers | 29 |
| ori1probe_new | TCTTCCGCACGACGTTTGGC | 5'Fam - 3'Tamra qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers | 29 |
| ORIqPCRfw | TTGATCCAAGCTTCCTGACA | qPCR primer for analysis of oriC in E. coli | 30 |
| ORIqPCRrv | GGCGAAACACTGAAGATCAA | qPCR primer for analysis of oriC in E. coli | 30 |
| ORIqPCRprobe | CCCAGCCATTCTTCTGCCGG | 5'Fam - 3'Tamra qPCR primer for analysis of oriC in E. coli | 30 |
| AToriCir_fw | TACGCACCTGTGGACAATCT | qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91 | 31 |
| AToriCir_rv | AAGTGGCGTCTCTCGTCTTC | qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91 | 31 |
| AToriCir_p | CCGTCTTATTCCAGTAATTCACAGGCG | 5'Fam - 3'Tamra qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91 | 31 |
| ATterCir_fw | GATGGGTCAGCACATGATTG | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81 | 32 |
| ATterCir_rv | ACGCCATCCTGATCGAAG | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81 | 32 |
| ATterCir_p | CGACGCTCGCCTTCCGTTTC | 5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81 | 32 |
| ATterLin_fw | ATGCTTCATGAGCTTTCGTG | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65 | 33 |
| ATterLin_rv | CAACGATACAGTTCCCGATG | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65 | 33 |
| ATterLin_p | TTCCAGCCATGTTGCGAGGC | 5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65 | 33 |
| AToriLin_fw | GTACATTAACGCTGCTTCGG | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89 | 34 |
| AToriLin_rv | TTGCATTAACCATAGGAAGCC | qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89 | 34 |
| AToriLin_p | CCGCCTTAAGCGAATCTTGCG | 5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89 | 34 |
| c_qPCR_v2.1 | AATGATACGGCGACCACCGAGATC | qPCR primer for quantification of Illumina ChIP library [4] | 35 |
| PE_qPCR_v2.2 | CAAGCAGAAGACGGCATACGAGATC | qPCR primer for quantification of Illumina ChIP library [4] | 35 |
| DLP | CCCTACACGACGCTCTTCCGATCT | 5'Fam 3'Tamra qPCR primer for quantification of Illumina ChIP library [4] | 35 |
- Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935.
- Rasmussen T, Jensen RB, and Skovgaard O. . pmid:17557077.
- Srivastava P and Chattoraj DK. . pmid:17944831.
- Quail MA, Kozarewa I, Smith F, Scally A, Stephens PJ, Durbin R, Swerdlow H, and Turner DJ. . pmid:19034268.


