User:Torsten Waldminghaus/qPCR-Primers: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(New page: {| border="3" ! Name !! Sequence !! Characteristics !! |- ! uvrDfw | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>) |- ! uvrDrv ...)
(No difference)

Revision as of 02:13, 16 December 2008

Name Sequence Characteristics
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region with no GATC-sites (Region B from [1])
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region with no GATC-sites (Region B from [1])
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region with no GATC-sites (Region B from Yamazoe et al., 200


  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. Sequential binding of SeqA protein to nascent DNA segments at replication forks in synchronized cultures of Escherichia coli. Mol Microbiol. 2005 Jan;55(1):289-98. DOI:10.1111/j.1365-2958.2004.04389.x | PubMed ID:15612935 | HubMed [Yamazoe-2005]