User:Torsten Waldminghaus/qPCR-Primers
From OpenWetWare
Jump to navigationJump to search
Name | Sequence | Characteristics | ||||||
---|---|---|---|---|---|---|---|---|
uvrDfw | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) | ||||||
uvrDrv | GTCAGCGTCAGTTTCTGCAT | qPCR for uvrD-region on E. coli chromosomewith no GATC-sites (Region B from [1]) | ||||||
uvrDprobe | AGACGCCCGCCTTCATCCAG | HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from [1] | ||||||
yahEFfw | CCATCGAGACGATCAAAGAA | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | ||||||
yahEFrv | CAGCATCTGGCTTTGTTGTT | qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | ||||||
yahEFprobe | AACTCGCGTCCTTCGGCAGC | HPLC5'Fam - 3'Tamra qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from [1]) | ||||||
cluster-fw | CTGACTGATGAGATCCAACGA | qPCR for GATC-cluster | cluster-rv | CTGGTGCTACGCCTGAATAA | qPCR for GATC-cluster | cluster-p | AAATTCGACCCGGCTGTCGC | qPCR for GATC-cluster |