User:Torsten Waldminghaus/qPCR-Primers - Revision history

Torsten Waldminghaus at 13:26, 24 August 2011

2011-08-24T13:26:53Z

←Older revision		Revision as of 13:26, 24 August 2011
Line 457:		Line 457:
	\|TACGCACCTGTGGACAATCT		\|TACGCACCTGTGGACAATCT
	\|qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91		\|qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91
-	\|	+	\|31
	\|-		\|-
	!AToriCir_rv		!AToriCir_rv
	\|AAGTGGCGTCTCTCGTCTTC		\|AAGTGGCGTCTCTCGTCTTC
	\|qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91		\|qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91
-	\|	+	\|31
	\|-		\|-
	!AToriCir_p		!AToriCir_p
	\|CCGTCTTATTCCAGTAATTCACAGGCG		\|CCGTCTTATTCCAGTAATTCACAGGCG
	\|5'Fam - 3'Tamra qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91		\|5'Fam - 3'Tamra qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91
-	\|	+	\|31
	\|-		\|-
	!ATterCir_fw		!ATterCir_fw
	\|GATGGGTCAGCACATGATTG		\|GATGGGTCAGCACATGATTG
	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81		\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81
-	\|	+	\|32
	\|-		\|-
	!ATterCir_rv		!ATterCir_rv
	\|ACGCCATCCTGATCGAAG		\|ACGCCATCCTGATCGAAG
	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81		\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81
-	\|	+	\|32
	\|-		\|-
	!ATterCir_p		!ATterCir_p
	\|CGACGCTCGCCTTCCGTTTC		\|CGACGCTCGCCTTCCGTTTC
	\|5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81		\|5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81
-	\|	+	\|32
	\|-		\|-
	!ATterLin_fw		!ATterLin_fw
	\|ATGCTTCATGAGCTTTCGTG		\|ATGCTTCATGAGCTTTCGTG
	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65		\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65
-	\|	+	\|33
	\|-		\|-
	!ATterLin_rv		!ATterLin_rv
	\|CAACGATACAGTTCCCGATG		\|CAACGATACAGTTCCCGATG
	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65		\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65
-	\|	+	\|33
	\|-		\|-
	!ATterLin_p		!ATterLin_p
	\|TTCCAGCCATGTTGCGAGGC		\|TTCCAGCCATGTTGCGAGGC
	\|5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65		\|5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65
-	\|	+	\|33
	\|-		\|-
	!AToriLin_fw		!AToriLin_fw
	\|GTACATTAACGCTGCTTCGG		\|GTACATTAACGCTGCTTCGG
	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89		\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89
-	\|	+	\|34
	\|-		\|-
	!AToriLin_rv		!AToriLin_rv
	\|TTGCATTAACCATAGGAAGCC		\|TTGCATTAACCATAGGAAGCC
	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89		\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89
-	\|	+	\|34
	\|-		\|-
	!AToriLin_p		!AToriLin_p
	\|CCGCCTTAAGCGAATCTTGCG		\|CCGCCTTAAGCGAATCTTGCG
	\|5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89		\|5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89
-	\|	+	\|34
		+	\|-
		+	!c_qPCR_v2.1
		+	\|AATGATACGGCGACCACCGAGATC
		+	\|qPCR primer for quantification of Illumina ChIP library <cite>quail-2008</cite>
		+	\|35
		+	\|-
		+	!PE_qPCR_v2.2
		+	\|CAAGCAGAAGACGGCATACGAGATC
		+	\|qPCR primer for quantification of Illumina ChIP library <cite>quail-2008</cite>
		+	\|35
		+	\|-
		+	!DLP
		+	\|CCCTACACGACGCTCTTCCGATCT
		+	\|5'Fam 3'Tamra qPCR primer for quantification of Illumina ChIP library <cite>quail-2008</cite>
		+	\|35
	\|-		\|-
	\|}		\|}
Line 521:		Line 536:
	#Rasmussen-2007 pmid=17557077		#Rasmussen-2007 pmid=17557077
	#chattoray-2007 pmid=17944831		#chattoray-2007 pmid=17944831
		+	#quail-2008 pmid=19034268
	</biblio>		</biblio>

Torsten Waldminghaus at 09:11, 12 August 2011

2011-08-12T09:11:34Z

←Older revision		Revision as of 09:11, 12 August 2011
Line 4:		Line 4:
	! Name !! Sequence !! Characteristics !!Probe set number		! Name !! Sequence !! Characteristics !!Probe set number
	\|-		\|-
-	! ~~uvrDfw~~	+	! test
	\| AGTTCCCGCAGGTGTTTATC		\| AGTTCCCGCAGGTGTTTATC
	\| qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)(region contains no HphI site so it can be used as control in methylation analysis)		\| qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)(region contains no HphI site so it can be used as control in methylation analysis)

Torsten Waldminghaus: User:Torsten Waldminghaus/Primers moved to User:Torsten Waldminghaus/qPCR-Primers

2011-08-12T09:09:35Z

User:Torsten Waldminghaus/Primers moved to User:Torsten Waldminghaus/qPCR-Primers

←Older revision

Revision as of 09:09, 12 August 2011

Torsten Waldminghaus at 09:09, 12 August 2011

2011-08-12T09:09:05Z

←Older revision		Revision as of 09:09, 12 August 2011
Line 1:		Line 1:
	*All primers are in concentrations of 100pmol/μL		*All primers are in concentrations of 100pmol/μL
-	*All Vibrio cholerae primers could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers

	{\| border="3"		{\| border="3"
Line 262:		Line 261:
	!ori1fw		!ori1fw
	\|AGATCAGCGTTGTCTTCACG		\|AGATCAGCGTTGTCTTCACG
-	\|qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961)	+	\|qPCR for ori1-region on Vibrio cholerae chromosome 1(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961. Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)
	\|19		\|19
	\|-		\|-
Line 277:		Line 276:
	!ter1Rfw		!ter1Rfw
	\|GCTATGGTGGAAGCACAAGA		\|GCTATGGTGGAAGCACAAGA
-	\|qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>Rasmussen-2007</cite>(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961)	+	\|qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>Rasmussen-2007</cite>(region arround 2959573-2959873 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)
	\|21		\|21
	\|-		\|-
Line 292:		Line 291:
	!ori2fw		!ori2fw
	\|CCTTGAGCTTGAGATTGCTG		\|CCTTGAGCTTGAGATTGCTG
-	\|qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961)	+	\|qPCR for ori2-region on Vibrio cholerae chromosome 2 (region arround 1070137-1070437 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)
	\|20		\|20
	\|-		\|-
Line 307:		Line 306:
	!ter2Rfw		!ter2Rfw
	\|CCAAAGTGCAACCGACTAAA		\|CCAAAGTGCAACCGACTAAA
-	\|qPCR for ter2-region on Vibrio cholerae chromosome 2 according to <cite>Rasmussen-2007</cite> (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 )	+	\|qPCR for ter2-region on Vibrio cholerae chromosome 2 according to <cite>Rasmussen-2007</cite> (region arround 501350-501650 Vibrio cholerae O1 biovar eltor str. N16961 ). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)
	\|22		\|22
	\|-		\|-
Line 322:		Line 321:
	!ter1Cfw		!ter1Cfw
	\|CACATACACGCAAACCACAA		\|CACATACACGCAAACCACAA
-	\|qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>chattoray-2007</cite> (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961)	+	\|qPCR for ter1-region on Vibrio cholerae chromosome 1 according to <cite>chattoray-2007</cite> (region arround 1514728-1515028 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)
	\|23		\|23
	\|-		\|-
Line 337:		Line 336:
	!ter2Cfw		!ter2Cfw
	\|AGTTCGGTGAGATTGGCATT		\|AGTTCGGTGAGATTGGCATT
-	\|qPCR for ter1-region on Vibrio cholerae chromosome 2 according to <cite>chattoray-2007</cite> (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961)	+	\|qPCR for ter1-region on Vibrio cholerae chromosome 2 according to <cite>chattoray-2007</cite> (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961). Primer set could be used for strain O1 biovar eltor str. N16961 as well as strain 2740-80 (identical sequence in the regions spanned by primers)
	\|24		\|24
	\|-		\|-

Torsten Waldminghaus at 11:39, 27 April 2011

2011-04-27T11:39:17Z

←Older revision		Revision as of 11:39, 27 April 2011
Line 454:		Line 454:
	\|5'Fam - 3'Tamra qPCR primer for analysis of oriC in E. coli		\|5'Fam - 3'Tamra qPCR primer for analysis of oriC in E. coli
	\|30		\|30
		+	\|-
		+	!AToriCir_fw
		+	\|TACGCACCTGTGGACAATCT
		+	\|qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91
		+	\|
		+	\|-
		+	!AToriCir_rv
		+	\|AAGTGGCGTCTCTCGTCTTC
		+	\|qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91
		+	\|
		+	\|-
		+	!AToriCir_p
		+	\|CCGTCTTATTCCAGTAATTCACAGGCG
		+	\|5'Fam - 3'Tamra qPCR primer for analysis of replication origin of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 91
		+	\|
		+	\|-
		+	!ATterCir_fw
		+	\|GATGGGTCAGCACATGATTG
		+	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81
		+	\|
		+	\|-
		+	!ATterCir_rv
		+	\|ACGCCATCCTGATCGAAG
		+	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81
		+	\|
		+	\|-
		+	!ATterCir_p
		+	\|CGACGCTCGCCTTCCGTTTC
		+	\|5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 81
		+	\|
		+	\|-
		+	!ATterLin_fw
		+	\|ATGCTTCATGAGCTTTCGTG
		+	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65
		+	\|
		+	\|-
		+	!ATterLin_rv
		+	\|CAACGATACAGTTCCCGATG
		+	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65
		+	\|
		+	\|-
		+	!ATterLin_p
		+	\|TTCCAGCCATGTTGCGAGGC
		+	\|5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 65
		+	\|
		+	\|-
		+	!AToriLin_fw
		+	\|GTACATTAACGCTGCTTCGG
		+	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89
		+	\|
		+	\|-
		+	!AToriLin_rv
		+	\|TTGCATTAACCATAGGAAGCC
		+	\|qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89
		+	\|
		+	\|-
		+	!AToriLin_p
		+	\|CCGCCTTAAGCGAATCTTGCG
		+	\|5'Fam - 3'Tamra qPCR primer for analysis of replication terminus of circular chrom. in Agrobacterium tumefaciens Amplicon Size = 89
		+	\|
	\|-		\|-
	\|}		\|}

Torsten Waldminghaus at 14:10, 3 November 2010

2010-11-03T14:10:28Z

←Older revision		Revision as of 14:10, 3 November 2010
Line 409:		Line 409:
	\|5'Fam - 3'Tamra qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome		\|5'Fam - 3'Tamra qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome
	\|28		\|28
		+	\|-
		+	!recNfw
		+	\|TTACGCCAGCCTCTTTACTG
		+	\|qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites)
		+	\|26
		+	\|-
		+	!recNrv
		+	\|AGCTCACGAACGATAGCAAA
		+	\|qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites)
		+	\|26
		+	\|-
		+	!recNprobe
		+	\|TTGGCACAACTGACCATCAGCAA
		+	\|5'Fam - 3'Tamra qPCR primer to detect lexA-binding in the promoter region of recN as positive control (see Rostas et al, 1987 for promoter of recN with lexA binding sites)
		+	\|26
		+	\|-
		+	!ori1fw_new
		+	\|AATCCGTGGAGAAGATCTGG
		+	\|qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers
		+	\|29
		+	\|-
		+	!ori1rv_new
		+	\|CCATGCTGGTTGAGAATACG
		+	\|qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers
		+	\|29
		+	\|-
		+	!ori1probe_new
		+	\|TCTTCCGCACGACGTTTGGC
		+	\|5'Fam - 3'Tamra qPCR primer to confirm ori/ter analysis with ori1 Vibrio primers
		+	\|29
		+	\|-
		+	!ORIqPCRfw
		+	\|TTGATCCAAGCTTCCTGACA
		+	\|qPCR primer for analysis of oriC in E. coli
		+	\|30
		+	\|-
		+	!ORIqPCRrv
		+	\|GGCGAAACACTGAAGATCAA
		+	\|qPCR primer for analysis of oriC in E. coli
		+	\|30
		+	\|-
		+	!ORIqPCRprobe
		+	\|CCCAGCCATTCTTCTGCCGG
		+	\|5'Fam - 3'Tamra qPCR primer for analysis of oriC in E. coli
		+	\|30
	\|-		\|-
	\|}		\|}

Torsten Waldminghaus at 13:27, 3 November 2010

2010-11-03T13:27:03Z

←Older revision		Revision as of 13:27, 3 November 2010
Line 368:		Line 368:
	\|CGCAACCCTTATCCTTTGTT		\|CGCAACCCTTATCCTTTGTT
	\|qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments		\|qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments
-	\|26	+	\|11
	\|-		\|-
	!2728013rv		!2728013rv
	\|TAAGGGCCATGATGACTTGA		\|TAAGGGCCATGATGACTTGA
	\|qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments		\|qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments
-	\|26	+	\|11
	\|-		\|-
	!2728013probe		!2728013probe
	\|CTCCTTTGAGTTCCCGGCCG		\|CTCCTTTGAGTTCCCGGCCG
	\|HPLC5'Fam - 3'Tamra qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments		\|HPLC5'Fam - 3'Tamra qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments
-	\|26	+	\|11
	\|-		\|-
	!ibpAqPCRfw		!ibpAqPCRfw

Torsten Waldminghaus at 09:20, 20 May 2009

2009-05-20T09:20:34Z

←Older revision		Revision as of 09:20, 20 May 2009
Line 349:		Line 349:
	\|HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 2 according to <cite>chattoray-2007</cite> (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961)		\|HPLC 5'Fam - 3'Tamra qPCR for ter1-region on Vibrio cholerae chromosome 2 according to <cite>chattoray-2007</cite> (region arround 461329-461629 Vibrio cholerae O1 biovar eltor str. N16961)
	\|24		\|24
		+	\|-
		+	!oriOpenfw
		+	\|CAACTTTGTCGGCTTGAGAA
		+	\|qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest
		+	\|25
		+	\|-
		+	!oriOpenrv
		+	\|TGATCCTTTCCAGGTTGTTG
		+	\|qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest
		+	\|25
		+	\|-
		+	!oriOpenprobe
		+	\|TCCACAGGGCAGTGCGATCC
		+	\|HPLC5'Fam - 3'Tamra qPCR for oriC region in Escherichia coli str. K-12 substr. MG1655 at the 13-mer sites to detect open complex formation after P1 digest
		+	\|25
	\|-		\|-
	!2728013fw		!2728013fw
	\|CGCAACCCTTATCCTTTGTT		\|CGCAACCCTTATCCTTTGTT
	\|qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments		\|qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments
-	\|	+	\|26
	\|-		\|-
	!2728013rv		!2728013rv
	\|TAAGGGCCATGATGACTTGA		\|TAAGGGCCATGATGACTTGA
	\|qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments		\|qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments
-	\|	+	\|26
	\|-		\|-
	!2728013probe		!2728013probe
	\|CTCCTTTGAGTTCCCGGCCG		\|CTCCTTTGAGTTCCCGGCCG
	\|HPLC5'Fam - 3'Tamra qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments		\|HPLC5'Fam - 3'Tamra qPCR for region 2727638 on Escherichia coli str. K-12 substr. MG1655 complete genome rrsG (16S rRNA), region with high unspecific binnding in ChIP experiments
-	\|	+	\|26
	\|-		\|-
	!ibpAqPCRfw		!ibpAqPCRfw
	\|AGGTAGCCAGAACACCCATC		\|AGGTAGCCAGAACACCCATC
	\|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP		\|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
-	\|	+	\|27
	\|-		\|-
	!ibpAqPCRrv		!ibpAqPCRrv
	\|AAGTCCGCTGATAAGGCTTG		\|AAGTCCGCTGATAAGGCTTG
	\|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP		\|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
-	\|	+	\|27
	\|-		\|-
	!ibpAqPCRprobe		!ibpAqPCRprobe
	\|CGCGTCCTCATCGGCTACGA		\|CGCGTCCTCATCGGCTACGA
	\|HPLC5'Fam - 3'Tamra qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP		\|HPLC5'Fam - 3'Tamra qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
-	\|	+	\|27
		+	\|-
		+	!rpsDfw
		+	\|AAGTTGATGCTGGCAAGATG
		+	\|qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome
		+	\|28
		+	\|-
		+	!rpsDrv
		+	\|TAAAGCTCGACGATCAGGTG
		+	\|qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome
		+	\|28
		+	\|-
		+	!rpsDprobe
		+	\|TCAGAACGCTCCGGCTTACGC
		+	\|5'Fam - 3'Tamra qPCR for region 3439800 on Escherichia coli str. K-12 substr. MG1655 complete genome rpsD, region with high unspecific binnding in ChIP experiments as primers 2728013 but without homologous sequences elsewhere on the chromosome
		+	\|28
	\|-		\|-
	\|}		\|}

Torsten Waldminghaus at 15:22, 22 April 2009

2009-04-22T15:22:07Z

←Older revision		Revision as of 15:22, 22 April 2009
Line 17:		Line 17:
	!uvrDprobe		!uvrDprobe
	\|AGACGCCCGCCTTCATCCAG		\|AGACGCCCGCCTTCATCCAG
-	\|HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)(region contains no HphI site so it can be used as control in methylation analysis)	+	\|HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region on E. coli chromosome with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>)(region contains no HphI site so it can be used as control in methylation analysis); chrom. position at bp 337400
	\|1		\|1
	\|-		\|-
	! yahEFfw		! yahEFfw
	\| CCATCGAGACGATCAAAGAA		\| CCATCGAGACGATCAAAGAA
-	\| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>)	+	\| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>); chrom. position at bp 337400
	\|2		\|2
	\|-		\|-
	! yahEFrv		! yahEFrv
	\| CAGCATCTGGCTTTGTTGTT		\| CAGCATCTGGCTTTGTTGTT
-	\| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>)	+	\| qPCR for yahEF-region on E. coli chromosome with many GATC-sites (Region 2 from <cite>Yamazoe-2005</cite>); chrom. position at bp 337400
	\|2		\|2
	\|-		\|-

Torsten Waldminghaus at 12:57, 22 April 2009

2009-04-22T12:57:39Z

←Older revision		Revision as of 12:57, 22 April 2009
Line 365:		Line 365:
	\|		\|
	\|-		\|-
-	!~~ibpAfw~~	+	!ibpAqPCRfw
	\|AGGTAGCCAGAACACCCATC		\|AGGTAGCCAGAACACCCATC
	\|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP		\|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
	\|		\|
	\|-		\|-
-	!~~ibpArv~~	+	!ibpAqPCRrv
	\|AAGTCCGCTGATAAGGCTTG		\|AAGTCCGCTGATAAGGCTTG
	\|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP		\|qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP
	\|		\|
	\|-		\|-
-	!~~ibpAprobe~~	+	!ibpAqPCRprobe
	\|CGCGTCCTCATCGGCTACGA		\|CGCGTCCTCATCGGCTACGA
	\|HPLC5'Fam - 3'Tamra qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP		\|HPLC5'Fam - 3'Tamra qPCR for region 3865545 on Escherichia coli str. K-12 substr. MG1655 complete genome ibpA, region should give high sigma32 IP