User:Torsten Waldminghaus/qPCR-Primers

From OpenWetWare

< User:Torsten Waldminghaus
Revision as of 05:13, 16 December 2008 by Torsten Waldminghaus (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Name Sequence Characteristics
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region with no GATC-sites (Region B from [1])
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region with no GATC-sites (Region B from [1])
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region with no GATC-sites (Region B from Yamazoe et al., 200


  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. . pmid:15612935. PubMed HubMed [Yamazoe-2005]
Personal tools